"""
Create simulated solexa/illumina runfolders for testing
"""
-
+import gzip
import os
import shutil
TESTDATA_DIR = os.path.join(TEST_CODE_DIR, 'testdata')
LANE_LIST = range(1,9)
TILE_LIST = range(1,101)
+HISEQ_TILE_LIST = [1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108,
+ 1201, 1202, 1203, 1204, 1205, 1206, 1207, 1208,
+ 2101, 2102, 2103, 2104, 2105, 2106, 2107, 2108,
+ 2201, 2202, 2203, 2204, 2205, 2206, 2207, 2208,]
def make_firecrest_dir(data_dir, version="1.9.2", start=1, stop=37):
- firecrest_dir = os.path.join(data_dir,
+ firecrest_dir = os.path.join(data_dir,
'C%d-%d_Firecrest%s_12-04-2008_diane' % (start, stop, version)
)
os.mkdir(firecrest_dir)
return firecrest_dir
-
+
def make_ipar_dir(data_dir, version='1.01'):
"""
Construct an artificial ipar parameter file and directory
f.write(config)
f.close()
+def make_runinfo(runfolder_dir, flowcell_id):
+ """Simulate a RunInfo.xml file created by >= RTA 1.9
+ """
+ xml = '''<?xml version="1.0"?>
+<RunInfo xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" Version="2">
+ <Run Id="{runfolder}" Number="101">
+ <Flowcell>{flowcell}</Flowcell>
+ <Instrument>SN787</Instrument>
+ <Date>110815</Date>
+ <Reads>
+ <Read Number="1" NumCycles="50" IsIndexedRead="N" />
+ <Read Number="2" NumCycles="7" IsIndexedRead="Y" />
+ </Reads>
+ <FlowcellLayout LaneCount="8" SurfaceCount="2" SwathCount="3" TileCount="8" />
+ <AlignToPhiX />
+ </Run>
+</RunInfo>
+'''
+ path, runfolder = os.path.split(runfolder_dir)
+ runinfo = os.path.join(runfolder_dir, 'RunInfo.xml')
+ stream = open(runinfo, 'w')
+ stream.write(xml.format(runfolder=runfolder, flowcell=flowcell_id))
+ stream.close()
+ return runinfo
+
def make_bustard_config132(image_dir):
source = os.path.join(TESTDATA_DIR, 'bustard-config132.xml')
destination = os.path.join(image_dir, 'config.xml')
shutil.copy(source, destination)
+def make_aligned_config_1_12(aligned_dir):
+ """This is rouglhly equivalent to the old gerald file"""
+ source = os.path.join(TESTDATA_DIR, '1_12', 'aligned_config_1_12.xml')
+ destination = os.path.join(aligned_dir, 'config.xml')
+ shutil.copy(source, destination)
+
+def make_unaligned_config_1_12(unaligned_dir):
+ demultiplex_pairs = [ # (src,
+ # dest),
+ (os.path.join(TESTDATA_DIR, '1_12', 'demultiplex_1.12.4.2.xml'),
+ os.path.join(unaligned_dir, 'DemultiplexConfig.xml')),
+ (os.path.join(TESTDATA_DIR, '1_12',
+ 'demultiplexed_bustard_1.12.4.2.xml'),
+ os.path.join(unaligned_dir, 'DemultiplexedBustardConfig.xml')),
+ (os.path.join(TESTDATA_DIR, '1_12',
+ 'demultiplexed_summary_1.12.4.2.xml'),
+ os.path.join(unaligned_dir, 'DemultiplexedBustardSummary.xml')),
+ ]
+ for src, dest in demultiplex_pairs:
+ shutil.copy(src, dest)
+
+def make_unaligned_status_1_12(unaligned_dir, flowcell_id):
+ basecall_status = ['All.htm', 'Demultiplex_Stats.htm', 'IVC.htm']
+ test_data_root = os.path.join(TESTDATA_DIR, '1_12', 'basecall_stats')
+ basecall_stats = os.path.join(unaligned_dir,
+ 'Basecall_Stats_{0}'.format(flowcell_id))
+ os.mkdir(basecall_stats)
+ for filename in basecall_status:
+ source = os.path.join(test_data_root, filename)
+ destination = os.path.join(basecall_stats, filename)
+ shutil.copy(source, destination)
+
def make_rta_intensities_1460(data_dir, version='1.4.6.0'):
"""
Construct an artificial RTA Intensities parameter file and directory
intensities_dir = os.path.join(data_dir, 'Intensities')
if not os.path.exists(intensities_dir):
os.mkdir(intensities_dir)
-
+
param_file = os.path.join(TESTDATA_DIR, 'rta_intensities_config.xml')
shutil.copy(param_file, os.path.join(intensities_dir, 'config.xml'))
basecalls_dir = os.path.join(intensities_dir, 'BaseCalls')
if not os.path.exists(basecalls_dir):
os.mkdir(basecalls_dir)
-
+
param_file = os.path.join(TESTDATA_DIR, 'rta_basecalls_config.xml')
shutil.copy(param_file, os.path.join(basecalls_dir, 'config.xml'))
return basecalls_dir
-def make_qseqs(bustard_dir, in_temp=True):
+def make_rta_intensities_1870(data_dir, version='1.8.70.0'):
+ """
+ Construct an artificial RTA Intensities parameter file and directory
+ """
+ intensities_dir = os.path.join(data_dir, 'Intensities')
+ if not os.path.exists(intensities_dir):
+ os.mkdir(intensities_dir)
+
+ param_file = os.path.join(TESTDATA_DIR, 'rta_intensities_config_1870.xml')
+ shutil.copy(param_file, os.path.join(intensities_dir, 'config.xml'))
+
+ return intensities_dir
+
+def make_rta_intensities_1_10(data_dir, version='1.10.36.0'):
+ """
+ Construct an artificial RTA Intensities parameter file and directory
+ """
+ intensities_dir = os.path.join(data_dir, 'Intensities')
+ if not os.path.exists(intensities_dir):
+ os.mkdir(intensities_dir)
+
+ param_file = os.path.join(TESTDATA_DIR, 'rta_intensities_config_1.10.xml')
+ shutil.copy(param_file, os.path.join(intensities_dir, 'config.xml'))
+
+ return intensities_dir
+
+def make_rta_intensities_1_12(data_dir, version='1.12.4.2'):
+ """
+ Construct an artificial RTA Intensities parameter file and directory
+ """
+ intensities_dir = os.path.join(data_dir, 'Intensities')
+ if not os.path.exists(intensities_dir):
+ os.mkdir(intensities_dir)
+
+ param_file = os.path.join(TESTDATA_DIR, '1_12',
+ 'rta_intensities_config_1.12.4.2.xml')
+ shutil.copy(param_file, os.path.join(intensities_dir, 'RTAConfig.xml'))
+
+ return intensities_dir
+
+def make_rta_basecalls_1870(intensities_dir):
+ """
+ Construct an artificial RTA Intensities parameter file and directory
+ """
+ basecalls_dir = os.path.join(intensities_dir, 'BaseCalls')
+ if not os.path.exists(basecalls_dir):
+ os.mkdir(basecalls_dir)
+
+ param_file = os.path.join(TESTDATA_DIR, 'rta_basecalls_config_1870.xml')
+ shutil.copy(param_file, os.path.join(basecalls_dir, 'config.xml'))
+
+ return basecalls_dir
+
+def make_rta_basecalls_1_10(intensities_dir):
+ """
+ Construct an artificial RTA Intensities parameter file and directory
+ """
+ basecalls_dir = os.path.join(intensities_dir, 'BaseCalls')
+ if not os.path.exists(basecalls_dir):
+ os.mkdir(basecalls_dir)
+
+ make_qseqs(basecalls_dir, basecall_info=ABXX_BASE_CALL_INFO)
+ param_file = os.path.join(TESTDATA_DIR, 'rta_basecalls_config_1.10.xml')
+ shutil.copy(param_file, os.path.join(basecalls_dir, 'config.xml'))
+
+ return basecalls_dir
+
+def make_rta_basecalls_1_12(intensities_dir):
+ """
+ Construct an artificial RTA Intensities parameter file and directory
+ """
+ basecalls_dir = os.path.join(intensities_dir, 'BaseCalls')
+ if not os.path.exists(basecalls_dir):
+ os.mkdir(basecalls_dir)
+
+ make_qseqs(basecalls_dir, basecall_info=ABXX_BASE_CALL_INFO)
+ param_file = os.path.join(TESTDATA_DIR, '1_12',
+ 'rta_basecalls_config_1.12.4.2.xml')
+ shutil.copy(param_file, os.path.join(basecalls_dir, 'config.xml'))
+
+ return basecalls_dir
+
+
+def make_qseqs(bustard_dir, basecall_info=None):
"""
Fill gerald directory with qseq files
"""
+ if basecall_info is None:
+ qseq_file = '42BRJAAXX_8_1_0039_qseq.txt'
+ tile_list = TILE_LIST
+ summary_file = '42BRJAAXX_BustardSummary.xml'
+ else:
+ qseq_file = basecall_info.qseq_file
+ tile_list = basecall_info.tile_list
+ summary_file = basecall_info.basecall_summary
+
# 42BRJ 8 1 0039 happened to be a better than usual tile, in that there
# was actually sequence at the start
- source = os.path.join(TESTDATA_DIR, '42BRJAAXX_8_1_0039_qseq.txt')
+ source = os.path.join(TESTDATA_DIR, qseq_file)
destdir = bustard_dir
if not os.path.isdir(destdir):
os.mkdir(destdir)
-
+
for lane in LANE_LIST:
- for tile in TILE_LIST:
+ for tile in tile_list:
destination = os.path.join(bustard_dir, 's_%d_1_%04d_qseq.txt' % (lane, tile))
shutil.copy(source, destination)
make_matrix_dir(bustard_dir)
make_phasing_dir(bustard_dir)
- summary_source = os.path.join(TESTDATA_DIR, '42BRJAAXX_BustardSummary.xml')
+ summary_source = os.path.join(TESTDATA_DIR, summary_file)
summary_dest = os.path.join(bustard_dir, 'BustardSummary.xml')
shutil.copy(summary_source, summary_dest)
-
+
return destdir
def make_scores(gerald_dir, in_temp=True):
destdir = os.path.join(destdir, 'Temp')
if not os.path.isdir(destdir):
os.mkdir(destdir)
-
+
for lane in LANE_LIST:
for tile in TILE_LIST:
destination = os.path.join(destdir, 's_%d_%04d_score.txt' % (lane, tile))
shutil.copy(source, destination)
-
+
return destdir
def make_matrix_dir(bustard_dir):
"""
Create several matrix files in <bustard_dir>/Matrix/
- from pipeline 1.4
+ from pipeline 1.4
"""
destdir = os.path.join(bustard_dir, 'Matrix')
if not os.path.isdir(destdir):
os.mkdir(destdir)
-
+
source = os.path.join(TESTDATA_DIR, '42BRJAAXX_8_02_matrix.txt')
for lane in LANE_LIST:
destination = os.path.join(destdir, 's_%d_02_matrix.txt' % ( lane, ))
shutil.copy(source, destination)
-
+
def make_matrix(matrix_filename):
contents = """# Auto-generated frequency response matrix
> A
f.write(contents)
f.close()
+def make_matrix_dir_rta160(bustard_dir):
+ """
+ Create several matrix files in <bustard_dir>/Matrix/
+ """
+ destdir = os.path.join(bustard_dir, 'Matrix')
+ if not os.path.isdir(destdir):
+ os.mkdir(destdir)
+
+ source = os.path.join(TESTDATA_DIR, '61MMFAAXX_4_1_matrix.txt')
+ lane_fragments = [ "_%d" % (l,) for l in LANE_LIST]
+ for fragment in lane_fragments:
+ destination = os.path.join(destdir, 's%s_1_matrix.txt' % ( fragment, ))
+ shutil.copy(source, destination)
+
+def make_matrix_dir_rta_1_10(bustard_dir):
+ make_matrix_dir_rta160(bustard_dir)
+
+def make_matrix_dir_rta_1_12(bustard_dir):
+ make_matrix_dir_rta160(bustard_dir)
+
def make_phasing_dir(bustard_dir):
"""
Create several phasing files in <bustard_dir>/Phasing/
destdir = os.path.join(bustard_dir, 'Phasing')
if not os.path.isdir(destdir):
os.mkdir(destdir)
-
+
source = os.path.join(TESTDATA_DIR, '42BRJAAXX_8_01_phasing.xml')
for lane in LANE_LIST:
destination = os.path.join(destdir, 's_%d_01_phasing.xml' % ( lane, ))
shutil.copy(source, destination)
-
+
def make_phasing_params(bustard_dir):
for lane in LANE_LIST:
pathname = os.path.join(bustard_dir, 'params%d.xml' % (lane))
destination = os.path.join(gerald_dir, 'config.xml')
shutil.copy(source, destination)
+def make_gerald_config_1_7(gerald_dir):
+ """CASAVA 1.7 gerald config"""
+ source = os.path.join(TESTDATA_DIR, 'gerald_config_1.7.xml')
+ destination = os.path.join(gerald_dir, 'config.xml')
+ shutil.copy(source, destination)
+
def make_summary_htm_100(gerald_dir):
source = os.path.join(TESTDATA_DIR, 'Summary-pipeline100.htm')
destination = os.path.join(gerald_dir, 'Summary.htm')
destination = os.path.join(gerald_dir, 'Summary.htm')
shutil.copy(source, destination)
+def make_summary_rta160_xml(gerald_dir):
+ source = os.path.join(TESTDATA_DIR, 'Summary-rta160.xml')
+ destination = os.path.join(gerald_dir, 'Summary.xml')
+ shutil.copy(source, destination)
+
+
+def make_summary_casava1_7_xml(gerald_dir):
+ source = os.path.join(TESTDATA_DIR, 'Summary-casava1.7.xml')
+ destination = os.path.join(gerald_dir, 'Summary.xml')
+ shutil.copy(source, destination)
+
+def make_status_rta1_12(datadir):
+ sourcedir = os.path.join(TESTDATA_DIR, '1_12')
+ status_htm = os.path.join(sourcedir, 'Status.htm')
+ destination = os.path.join(datadir, 'Status.htm')
+ shutil.copy(status_htm, destination)
+
+ status_dir = os.path.join(datadir, 'Status_Files')
+ status_source_dir = os.path.join(sourcedir, 'Status_Files')
+ shutil.copytree(status_source_dir, status_dir)
+
+ report_source_dir = os.path.join(sourcedir, 'reports')
+ report_dir = os.path.join(datadir, 'reports')
+ shutil.copytree(report_source_dir, report_dir)
+
def make_eland_results(gerald_dir):
eland_result = """>HWI-EAS229_24_207BTAAXX:1:7:599:759 ACATAGNCACAGACATAAACATAGACATAGAC U0 1 1 3 chrUextra.fa 28189829 R D.
>HWI-EAS229_24_207BTAAXX:1:7:205:842 AAACAANNCTCCCAAACACGTAAACTGGAAAA U1 0 1 0 chr2L.fa 8796855 R DD 24T
>HWI-EAS229_60_30DP9AAXX:1:1:931:747 AAAAAAGCAAATTTCATTCACATGTTCTGTGTTCATA 1:0:0 spike.fa/sample1:55269838R0
>HWI-EAS229_60_30DP9AAXX:1:1:931:747 AAAAAAGCAAATTTCATTCACATGTTCTGTGTTCATA 1:0:0 spike.fa/sample2:55269838R0
""", """>HWI-EAS229_60_30DP9AAXX:1:1:1221:788 AAGATATCTACGACGTGGTATGGCGGTGTCTGGTCGT NM
->HWI-EAS229_60_30DP9AAXX:1:1:1221:788 NNNNNNNNNNNNNNGTGGTATGGCGGTGTCTGGTCGT QC
+>HWI-EAS229_60_30DP9AAXX:1:1:1221:788 NNNNNNNNNNNNNNGTGGTATGGCGGTGTCTGGTCGT QC
>HWI-EAS229_60_30DP9AAXX:1:1:931:747 AAAAAAGCAAATTTCATTCACATGTTCTGTGTTCATA 1:0:2 chr5.fa:55269838R0
>HWI-EAS229_60_30DP9AAXX:1:1:1121:379 AGAAGAGACATTAAGAGTTCCTGAAATTTATATCTGG 2:1:0 chr16.fa:46189180R1,chr7.fa:122968519R0,chr8.fa:48197174F0,chr7.fa:22516603F1,chr9.fa:134886204R
>HWI-EAS229_60_30DP9AAXX:1:1:892:1155 ACATTCTCCTTTCCTTCTGAAGTTTTTACGATTCTTT 0:9:10 chr10.fa:114298201F1,chr12.fa:8125072F1,19500297F2,42341293R2,chr13.fa:27688155R2,95069772R1,chr15.fa:51016475F2,chr16.fa:27052155F2,chr1.fa:192426217R2,chr21.fa:23685310R2,chr2.fa:106680068F1,chr3.fa:185226695F2,chr4.fa:106626808R2,chr5.fa:14704894F1,43530779F1,126543189F2,chr6.fa:74284101F1
f.write(eland_multi[0])
f.close()
+def make_eland_export(gerald_dir, paired=False, lane_list=LANE_LIST):
+ source = os.path.join(TESTDATA_DIR, 'casava_1.7_export.txt')
+
+ for i in lane_list:
+ destination = os.path.join(gerald_dir,
+ 's_%d_export.txt' % (i,))
+ shutil.copy(source, destination)
+
+
def make_scarf(gerald_dir, lane_list=LANE_LIST):
seq = """HWI-EAS229_92_30VNBAAXX:1:1:0:161:NCAATTACACGACGCTAGCCCTAAAGCTATTTCGAGG:E[aaaabb^a\a_^^a[S`ba_WZUXaaaaaaUKPER
HWI-EAS229_92_30VNBAAXX:1:1:0:447:NAGATGCGCATTTGAAGTAGGAGCAAAAGATCAAGGT:EUabaab^baabaaaaaaaa^^Uaaaaa\aaaa__`a
seq = """@HWI-EAS229:1:2:182:712#0/1
AAAAAAAAAAAAAAAAAAAAANAAAAAAAAAAAAAAA
+HWI-EAS229:1:2:182:712#0/1
-\bab_bbaabbababbaaa]]D]bb_baabbab\baa
+\\bab_bbaabbababbaaa]]D]bb_baabbab\baa
@HWI-EAS229:1:2:198:621#0/1
CCCCCCCCCCCCCCCCCCCCCNCCCCCCCCCCCCCCC
+HWI-EAS229:1:2:198:621#0/1
f.write(seq)
f.close()
+UNALIGNED_READS = [1,2]
+UNALIGNED_SAMPLES = [ (1, UNALIGNED_READS, '11111', None, None),
+ (2, UNALIGNED_READS, '11112', None, None),
+ (3, UNALIGNED_READS, '11113', 1, 'ATCACG'),
+ (3, UNALIGNED_READS, '11113', 2, 'CGATGT'),
+ (3, UNALIGNED_READS, '11113', 3, 'TTAGGC'),
+ (4, UNALIGNED_READS, '11114', 6, 'GCCAAT'),
+ (5, UNALIGNED_READS, '11115', 1, 'ATCACG'),
+ (5, UNALIGNED_READS, '11116', 7, 'ACTTGA'),
+ (5, UNALIGNED_READS, '11117', 9, 'GATCAG'),
+ (6, UNALIGNED_READS, '11118', 1, 'ATCACG'),
+ (7, UNALIGNED_READS, '11119', 2, 'CGATGT'),
+ (8, UNALIGNED_READS, '11120', 3, 'TTAGGC'),
+ (1, UNALIGNED_READS, None, None, None),
+ (2, UNALIGNED_READS, None, None, None),
+ (3, UNALIGNED_READS, None, None, None),
+ (4, UNALIGNED_READS, None, None, None),
+ (5, UNALIGNED_READS, None, None, None)]
+
+
+def make_aligned_eland_export(aligned_dir, flowcell_id):
+ summary_source = os.path.join(TESTDATA_DIR, 'sample_summary_1_12.htm')
+ for lane, read, project_id, index_id, index_seq in UNALIGNED_SAMPLES:
+ paths = DemultiplexedPaths(aligned_dir,
+ flowcell_id,
+ lane,
+ project_id,
+ index_id,
+ index_seq)
+ paths.make_sample_dirs()
+ paths.make_summary_dirs()
+ summary_dest = os.path.join(paths.summary_dir, 'Sample_Summary.htm')
+ shutil.copy(summary_source, summary_dest)
+
+ body = get_aligned_sample_export(lane, index_seq)
+ for split in ['001','002']:
+ for read in UNALIGNED_READS:
+ suffix = 'R{0}_{1}_export.txt.gz'.format(read, split)
+ pathname = paths.make_test_filename(suffix)
+ stream = gzip.open(pathname, 'w')
+ stream.write(body)
+ stream.close()
+
+
+def make_unaligned_fastqs_1_12(unaligned_dir, flowcell_id):
+ """Create a default mix of unaligned sample files
+ """
+ for lane, read, name, index_id, index in UNALIGNED_SAMPLES:
+ make_unaligned_fastq_sample_1_12(unaligned_dir,
+ flowcell_id,
+ lane,
+ read,
+ name,
+ index_id,
+ index)
+
+def make_unaligned_fastq_sample_1_12(unaligned_dir,
+ flowcell_id,
+ lane,
+ reads,
+ project_id,
+ index_id=None,
+ index_seq=None):
+
+ paths = DemultiplexedPaths(unaligned_dir,
+ flowcell_id,
+ lane,
+ project_id,
+ index_id,
+ index_seq)
+ paths.make_sample_dirs()
+
+ sample_seq = get_unaligned_sample_fastq_data(flowcell_id, lane, index_seq)
+ for split in ['001','002']:
+ for read in reads:
+ suffix = 'R{0}_{1}.fastq.gz'.format(read, split)
+ pathname = paths.make_test_filename(suffix)
+ stream = gzip.open(pathname, 'w')
+ stream.write(sample_seq)
+ stream.close()
+
+ sheetname = os.path.join(paths.sample_dir, 'SampleSheet.csv')
+ stream = open(sheetname, 'w')
+ stream.write('FCID,Lane,SampleID,SampleRef,Index,Description,Control,Recipe,Operator,SampleProject'+os.linesep)
+ template = '{flowcell},{lane},{id},mm9,{index},Sample #{id},N,PR_indexing,Operator,{sample_project}'+os.linesep
+ stream.write(template.format(flowcell=flowcell_id,
+ lane=lane,
+ id=paths.sample_id,
+ index=paths.index_seq,
+ sample_project=paths.sample_project))
+ stream.close()
+
+
+class DemultiplexedPaths(object):
+ def __init__(self, basedir, flowcell_id, lane, project_id, index_id, index_seq):
+ if lane not in LANE_LIST:
+ raise ValueError("Invalid lane ID: {0}".format(lane))
+ self.basedir = basedir
+ self.flowcell_id = flowcell_id
+ self.lane = lane
+
+ if project_id is None:
+ # undetermined
+ self.index_seq = ''
+ self.sample_id = 'lane{0}'.format(lane)
+ self.sample_project = 'Undetermined_indices'
+ self.rootname = 'lane{lane}_Undetermined_L00{lane}_'.format(
+ lane=lane)
+ self.project_dir = 'Undetermined_indices'
+ self.sample_dir = 'Sample_lane{lane}'.format(lane=lane)
+ elif index_seq is None:
+ self.index_seq = ''
+ self.sample_id = project_id
+ self.sample_project = '{project_id}'.format(project_id=project_id)
+ self.rootname = '{project_id}_NoIndex_L00{lane}_'.format(
+ project_id=project_id,
+ lane=lane)
+ self.project_dir = 'Project_' + self.sample_project
+ self.sample_dir = 'Sample_{project_id}'.format(
+ project_id=project_id)
+ else:
+ self.index_seq = index_seq
+ self.sample_id = project_id
+ self.sample_project = '{project_id}_Index{index_id}'.format(
+ project_id=project_id,
+ index_id=index_id)
+ self.rootname = '{project_id}_{index}_L00{lane}_'.format(
+ project_id=project_id,
+ index=index_seq,
+ lane=lane)
+ self.project_dir = 'Project_' + self.sample_project
+ self.sample_dir = 'Sample_{project_id}'.format(
+ project_id=project_id)
+
+ self.project_dir = os.path.join(self.basedir, self.project_dir)
+ self.sample_dir = os.path.join(self.project_dir, self.sample_dir)
+ self.summary_dir = 'Summary_Stats_{0}'.format(self.flowcell_id)
+ self.summary_dir = os.path.join(self.project_dir, self.summary_dir)
+
+
+ def make_sample_dirs(self):
+ if not os.path.isdir(self.project_dir):
+ os.mkdir(self.project_dir)
+ if not os.path.isdir(self.sample_dir):
+ os.mkdir(self.sample_dir)
+
+ def make_summary_dirs(self):
+ if not os.path.isdir(self.summary_dir):
+ os.mkdir(self.summary_dir)
+
+ def make_test_filename(self, suffix):
+ filename = self.rootname + suffix
+ pathname = os.path.join(self.sample_dir, filename)
+ return pathname
+
+ def dump(self):
+ print ('index seq: {0}'.format(self.index_seq))
+
+ print ('project dir: {0}'.format(self.project_dir))
+ print ('sample dir: {0}'.format(self.sample_dir))
+ print ('rootname: {0}'.format(self.rootname))
+ print ('path: {0}'.format(
+ os.path.join(self.project_dir,
+ self.sample_dir,
+ self.rootname+'R1_001.fastq.gz')))
+
+
+def get_unaligned_sample_fastq_data(flowcell_id, lane, index_seq):
+ seq = """@HWI-ST0787:101:{flowcell}:{lane}:1101:2416:3469 1:Y:0:{index}
+TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA
++
+CCCFFFFFHHHHHJJJJJJJJJIJJJJJJJJJJJJJJJJIIJJIIJJJJJ
+@HWI-ST0787:101:{flowcell}:{lane}:1101:2677:3293 1:Y:0:{index}
+TGGAAATCCATTGGGGTTTCCCCTGGAATTCTCGGGTGCCAAGGAACTCC
++
+@CCFF3BDHHHHHIIIIIHHIIIDIIIGIIIEGIIIIIIIIIIIIIIIHH
+@HWI-ST0787:101:{flowcell}:{lane}:1101:2616:3297 1:Y:0:{index}
+TAATACTGCCGGGTAATGATGGCTGGAATTCTCGGGTGCCAAGGAACTCC
++
+CCCFFFFFHHHHHCGHJJJJJJJJJJJJJJJJJIIJJJJJJJJJIHJJJI
+@HWI-ST0787:101:{flowcell}:{lane}:1101:2545:3319 1:N:0:{index}
+TCCTTCATTCCACCGGAGTCTGCTGGAATTCTCGGGTGCCAAGGAACTCC
++
+CCCFFFFFHHHFHJGIGHIJHIIGHIGIGIGEHFIJJJIHIJHJIIJJIH
+""".format(flowcell=flowcell_id, lane=lane, index=index_seq)
+ return seq
+
+def get_aligned_sample_export(lane, index_seq):
+ body = """HWI-ST0787\t102\t{lane}\t1101\t1207\t1993\t{index}\t1\tAANGGATTCGATCCGGCTTAAGAGATGAAAACCGAAAGGGCCGACCGAA\taaBS`ccceg[`ae[dRR_[[SPPPP__ececfYYWaegh^\\ZLLY\\X`\tNM\t\t\t\t\t\t
+HWI-ST0787\t102\t{lane}\t1101\t1478\t1997\t{index}\t1\tCAAGAACCCCGGGGGGGGGGGGGCAGAGAGGGGGAATTTTTTTTTTGTT\tBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB\tNM\t\t\t\t\t\t\t\t\t\t\tN
+HWI-ST0787\t102\t{lane}\t1101\t1625\t1994\t{index}\t1\tAANAATGCTACAGAGACAAAACAAAACTGATATGAAAGTTGAGAATAAA\tB^BS\cccgegg[Q[QQQ[`egdgffbeggfgh^^YcfgfhXaHY^O^c\tchr9.fa\t67717938\tR\t99\t72
+HWI-ST0787\t102\t{lane}\t1101\t1625\t1994\t{index}\t1\tAANAATGCTACAGAGACAAAACAAAACTGATATGAAAGTTGAGAATAAA\tB^BS\cccgegg[Q[QQQ[`egdgffbeggfgh^^YcfgfhXaHY^O^c\t3:4:3\t\t\t\t\t\t\t\t\t\t\tY
+""".format(lane=lane, index=index_seq)
+ return body
+
+def print_ls_tree(root):
+ """List tree contents, useful for debugging.
+ """
+ for dirpath, dirnames, filenames in os.walk(root):
+ for filename in filenames:
+ print os.path.join(dirpath, filename)
+
+class BaseCallInfo(object):
+ """Provide customization for how to setup the base call mock data
+ """
+ def __init__(self, qseq_file, tile_list, basecall_summary):
+ self.qseq_file = qseq_file
+ self.tile_list = tile_list
+ self.basecall_summary = basecall_summary
+
+# First generation HiSeq Flowcell
+ABXX_BASE_CALL_INFO = BaseCallInfo(
+ qseq_file='AA01CCABXX_8_2_2207_qseq.txt',
+ tile_list = HISEQ_TILE_LIST,
+ basecall_summary = 'AA01CCABXX_BustardSummary.xml')