X-Git-Url: http://woldlab.caltech.edu/gitweb/?p=mussa.git;a=blobdiff_plain;f=alg%2Ftest%2Ftest_mussa.cpp;h=5255fe26d7a309130c99b0369bbb8749fba7298a;hp=74f8a9c658e55047f7a8b2e24e4502eafd99e423;hb=97498410e1fc5c39eac0282a6620b8fcb0f02ff3;hpb=617cda1674d8e60bb443cecd293837d160220b80 diff --git a/alg/test/test_mussa.cpp b/alg/test/test_mussa.cpp index 74f8a9c..5255fe2 100644 --- a/alg/test/test_mussa.cpp +++ b/alg/test/test_mussa.cpp @@ -1,4 +1,7 @@ -#include +#define BOOST_TEST_DYN_LINK +#define BOOST_TEST_MODULE test_mussa +#include + #include #include namespace fs = boost::filesystem; @@ -109,6 +112,58 @@ BOOST_AUTO_TEST_CASE ( empty_mussa_set_threshold ) m.nway(); } +BOOST_AUTO_TEST_CASE( mussa_load_mupa_crlf ) +{ + fs::path example_path(EXAMPLE_DIR, fs::native); + fs::path seq_path(example_path / "seq" / "mouse_mck_pro.fa"); + fs::path annot_path(example_path / "mm_mck3test.annot"); + + std::string mupa( + "# hello\015\012" + "ANA_NAME load_mupa_crlf\015\012"); + mupa += "SEQUENCE " + seq_path.native_file_string() + "\015\012"; + mupa += "ANNOTATION " + annot_path.native_file_string() + "\015\012"; + + istringstream mupa_stream(mupa); + Mussa m; + fs::path base; + m.load_mupa_stream( mupa_stream, base ); + // Should run with no exceptions +} + +BOOST_AUTO_TEST_CASE( mussa_load_mupa_comment_character ) +{ + fs::path mupa_path(EXAMPLE_DIR, fs::native); + fs::path seq_path = fs::initial_path() / "seq" / "mouse_mck_pro.fa"; + fs::path annot_path = fs::initial_path() / "mm_mck3test.annot"; + + std::string mupa( + "# hello\015\012" + "ANA_NAME load_mupa_crlf\015\012"); + mupa += "#SEQUENCE " + seq_path.native_file_string() + "\015\012"; + mupa += "#ANNOTATION " + annot_path.native_file_string() + "\015\012"; + + istringstream mupa_stream(mupa); + Mussa m; + fs::path base; + m.load_mupa_stream( mupa_stream, base ); + // Should run with no exceptions +} + +BOOST_AUTO_TEST_CASE( mussa_load_mupa_exception ) +{ + std::string mupa( + "# hello\015\012" + "ANA_NAME load_mupa_crlf\015\012" + "mwahhaha I broke you!\n" + ); + + istringstream mupa_stream(mupa); + Mussa m; + fs::path base; + BOOST_CHECK_THROW(m.load_mupa_stream( mupa_stream, base ), mussa_load_error); +} + BOOST_AUTO_TEST_CASE( mussa_load_mupa ) { fs::path mupa_path(EXAMPLE_DIR, fs::native); @@ -151,6 +206,17 @@ BOOST_AUTO_TEST_CASE( mussa_load_full_path ) BOOST_CHECK_EQUAL( m1.is_dirty(), true); BOOST_CHECK_EQUAL( m1.get_analysis_path().string(), ""); } + +BOOST_AUTO_TEST_CASE( mussa_valid_motifs_in_new_analysis ) +{ + Mussa m1; + fs::path full_path(fs::path(EXAMPLE_DIR, fs::native) / "mck3test.mupa"); + m1.load_mupa_file( full_path ); + m1.analyze(); + // check motifs + BOOST_CHECK( m1.sequences().size() > 0 ); + BOOST_CHECK_EQUAL( m1.sequences()[0]->motifs().size(), 0 ); +} // make sure we know that mupa files cannot be directories BOOST_AUTO_TEST_CASE( mussa_mupa_is_file_not_directory ) @@ -160,6 +226,14 @@ BOOST_AUTO_TEST_CASE( mussa_mupa_is_file_not_directory ) BOOST_CHECK_THROW(m1.load_mupa_file( curdir ), mussa_load_error ); } +// catch error if annotation isn't a file +BOOST_AUTO_TEST_CASE( mussa_annotation_is_not_file ) +{ + Mussa m1; + fs::path full_path(fs::path(EXAMPLE_DIR, fs::native) / "directory.mupa"); + BOOST_CHECK_THROW( m1.load_mupa_file( full_path ), mussa_load_error ); +} + BOOST_AUTO_TEST_CASE( mussa_load_analysis ) { fs::path example_dir(EXAMPLE_DIR, fs::native); @@ -462,7 +536,6 @@ BOOST_AUTO_TEST_CASE( three_way_local_alignment ) result_i != result.end(); ++result_i) { - std::cout << "path "; ConservedPath::path_element first_element = *(result_i->begin()); for (ConservedPath::path_type::iterator element_i = result_i->begin(); element_i != result_i->end(); @@ -472,12 +545,23 @@ BOOST_AUTO_TEST_CASE( three_way_local_alignment ) BOOST_CHECK_EQUAL( s0[*element_i], s1[*element_i] ); BOOST_CHECK_EQUAL( s1[*element_i], s2[*element_i] ); BOOST_CHECK_EQUAL( s0[*element_i], s2[*element_i] ); - std::cout << *element_i << " " << s0[*element_i]; } - std::cout << std::endl; } } +BOOST_AUTO_TEST_CASE( mussa_window_larger_than_sequence ) +{ + string s0("AGCAGGG"); + string s1("CAGCGGG"); + + Mussa analysis; + analysis.append_sequence(s0); + analysis.append_sequence(s1); + analysis.set_threshold(23); + analysis.set_window(30); + BOOST_CHECK_THROW(analysis.analyze(), seqcomp_error); +} + BOOST_AUTO_TEST_CASE( subanalysis ) { Sequence s1("AATGAAGATTTTAATGCTTTAATTTTGTTTTGTAAACTTCGAATTTCCAAAATTTGAAA");