+
+BOOST_AUTO_TEST_CASE( mussa_name_embedded_quote_motif )
+{
+ // pretty obviously this shouldn't work as " are our delimiter
+ // and i'm too lazy to add support for \ in the parser
+ string data = "ATA 0.5 0.5 0.5\n"
+ "CCAATT \"cat \"meow 123\" 0.1 0.2 0.3\n";
+ istringstream test_istream(data);
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTCCAATT");
+ BOOST_CHECK_THROW( m1.load_motifs(test_istream), motif_load_error);
+
+ std::set<Sequence> motifs = m1.motifs();
+ BOOST_REQUIRE_EQUAL(motifs.size(), 0);
+}
+
+BOOST_AUTO_TEST_CASE( mussa_save_motif )
+{
+ string data = "ATA 1 1 1 1\n"
+ "CAT \"my name\" 1 0 0.5 0.5\n";
+ istringstream data_istream(data);
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTCCAATT");
+ m1.load_motifs(data_istream);
+
+ string save;
+ ostringstream save_ostream(save);
+ m1.save_motifs(save_ostream);
+
+ istringstream reloaded_istream(save_ostream.str());
+ Mussa m2;
+ m2.append_sequence("AAAAGGGGTTTT");
+ m2.append_sequence("GGGCCCCTTCCAATT");
+ m2.load_motifs(reloaded_istream);
+
+ BOOST_REQUIRE_EQUAL(m1.motifs().size(), m2.motifs().size());
+ Mussa::motif_set::const_iterator m1motif = m1.motifs().begin();
+ Mussa::motif_set::const_iterator m2motif = m2.motifs().begin();
+ for (;
+ m1motif != m1.motifs().end() and m2motif != m2.motifs().end();
+ ++m1motif, ++m2motif)
+ {
+ BOOST_CHECK_EQUAL(m1motif->get_sequence(), m2motif->get_sequence());
+ BOOST_CHECK_EQUAL(m1motif->get_name(), m2motif->get_name());
+ BOOST_CHECK_EQUAL(m1.colorMapper()->lookup("motif", m1motif->get_sequence()),
+ m2.colorMapper()->lookup("motif", m2motif->get_sequence()));
+ }
+}
+
+BOOST_AUTO_TEST_CASE( mussa_add_motif )
+{
+ vector<Sequence> motifs;
+ motifs.push_back("AAGG");
+ vector<Color> colors;
+ colors.push_back(Color(1.0, 0.0, 0.0));
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTGGTT");
+ m1.set_motifs(motifs, colors);
+ int first_size = m1.motifs().size();
+ BOOST_CHECK_EQUAL( first_size, 1 );
+ BOOST_REQUIRE(first_size > 0);
+ BOOST_CHECK_EQUAL(*(m1.motifs().begin()), motifs.front());
+ // make sure that our sequences have the right number of motifs
+ BOOST_CHECK_EQUAL(m1.sequences()[0]->motifs().size(), 1);
+ BOOST_CHECK_EQUAL(m1.sequences()[1]->motifs().size(), 1); // because of rc
+
+ // verify that setting the motif clears the arrays
+ m1.set_motifs(motifs, colors);
+ BOOST_CHECK_EQUAL( first_size, m1.motifs().size() );
+ // make sure that our sequences have the right number of motifs
+ BOOST_CHECK_EQUAL(m1.sequences()[0]->motifs().size(), 1);
+ BOOST_CHECK_EQUAL(m1.sequences()[1]->motifs().size(), 1);
+
+ // add a different motif
+ motifs.clear();
+ motifs.push_back("CCTTGG");
+ BOOST_CHECK_EQUAL(motifs.size(), 1);
+ m1.set_motifs(motifs, colors);
+ BOOST_CHECK_EQUAL(m1.motifs().size(), 1);
+ BOOST_REQUIRE(m1.motifs().size() > 0);
+ BOOST_CHECK_EQUAL(*(m1.motifs().begin()), motifs.front());
+ BOOST_CHECK_EQUAL(m1.sequences()[0]->motifs().size(), 0);
+ BOOST_CHECK_EQUAL(m1.sequences()[1]->motifs().size(), 1);
+
+ // try a motif that doesn't exist
+ motifs.clear();
+ motifs.push_back("CCTTGG");
+ BOOST_CHECK_EQUAL(motifs.size(), 1);
+ m1.set_motifs(motifs, colors);
+ BOOST_CHECK_EQUAL(m1.motifs().size(), 1);
+ BOOST_CHECK_EQUAL(m1.sequences()[0]->motifs().size(), 0);
+ BOOST_CHECK_EQUAL(m1.sequences()[1]->motifs().size(), 1);
+
+}
+
+static void
+two_way_local_align_test(const Mussa::vector_sequence_type &seqs,
+ const list<ConservedPath::path_type>& result,
+ const list<vector<bool> >& reversed)
+{
+ map<char, vector <char> > m;
+ assign::insert(m)('A', assign::list_of('A')('T') )
+ ('T', assign::list_of('T')('A') )
+ ('G', assign::list_of('G')('C') )
+ ('C', assign::list_of('C')('G') );
+ list<vector<bool> >::const_iterator rc_i = reversed.begin();
+
+ for(list<ConservedPath::path_type>::const_iterator base_i = result.begin();
+ base_i != result.end();
+ ++base_i, ++rc_i)
+ {
+ // since the reverse compliment flag is relative to the first sequence
+ // the first one should always be false
+ BOOST_CHECK_EQUAL( (*rc_i)[0], false );
+ const int first_path_basepair_index = (*base_i)[0];
+ const int second_path_basepair_index = (*base_i)[1];
+ const char first_basepair = (*seqs[0])[first_path_basepair_index];
+ const char second_basepair = (*seqs[1])[second_path_basepair_index];
+ // get our index into our reverse compliment map m
+ const int second_compliment_index = (*rc_i)[1];
+ // lookup the forward or reverse compliment depending on our rc flag
+ const char complimented_second = m[second_basepair][second_compliment_index];
+
+ BOOST_CHECK_EQUAL( first_basepair, complimented_second) ;
+ }
+}
+
+BOOST_AUTO_TEST_CASE( two_way_local_alignment )
+{
+ string s0("GCGCATAT");
+ string s1("AAAAAAAT");
+ Sequence seq1(s1);
+
+ Mussa analysis;
+ analysis.append_sequence(s0);
+ analysis.append_sequence(s1);
+ analysis.set_threshold(3);
+ analysis.set_window(4);
+ analysis.analyze();
+ NwayPaths npath = analysis.paths();
+ BOOST_REQUIRE_EQUAL( npath.pathz.size(), 2 );
+
+ list<ConservedPath::path_type> result;
+ list<vector<bool> > reversed;
+ list<ConservedPath>::iterator pathz_i = npath.pathz.begin();
+
+ list<ConservedPath> selected_paths;
+ selected_paths.push_back(*pathz_i);
+ analysis.createLocalAlignment(selected_paths.begin(),
+ selected_paths.end(),
+ result,
+ reversed);
+
+ two_way_local_align_test(analysis.sequences(), result, reversed);
+
+ ++pathz_i;
+ result.clear();
+ reversed.clear();
+ selected_paths.clear();
+ selected_paths.push_back(*pathz_i);
+ analysis.createLocalAlignment(selected_paths.begin(),
+ selected_paths.end(),
+ result,
+ reversed);
+ two_way_local_align_test(analysis.sequences(), result, reversed);
+}
+
+BOOST_AUTO_TEST_CASE( three_way_local_alignment )
+{
+ string s0("AGCAGGGAGGGTTTAAATGGCACCCAGCAGTTGGTGTGAGG");
+ string s1("AGCGGGAAGGGTTTAAATGGCACCGGGCAGTTGGCGTGAGG");
+ string s2("CAGCGCCGGGGTTTAAATGGCACCGAGCAGTTGGCGCAGGG");
+
+ Mussa analysis;
+ analysis.append_sequence(s0);
+ analysis.append_sequence(s1);
+ analysis.append_sequence(s2);
+ analysis.set_threshold(23);
+ analysis.set_window(30);
+ analysis.analyze();
+ NwayPaths npath = analysis.paths();
+ BOOST_CHECK_EQUAL( npath.refined_pathz.size(), 1 );
+
+ list<ConservedPath::path_type> result;
+ list<vector<bool> > reversed;
+ // grab 1 path (since there's only one)
+ list<ConservedPath>::iterator pathz_i = npath.pathz.begin();
+ list<ConservedPath> selected_paths;
+ selected_paths.push_back(*pathz_i);
+ analysis.createLocalAlignment(selected_paths.begin(),
+ selected_paths.end(),
+ result,
+ reversed);
+
+ for(std::list<ConservedPath::path_type>::iterator result_i = result.begin();
+ result_i != result.end();
+ ++result_i)
+ {
+ ConservedPath::path_element first_element = *(result_i->begin());
+ for (ConservedPath::path_type::iterator element_i = result_i->begin();
+ element_i != result_i->end();
+ ++element_i)
+ {
+ BOOST_CHECK_EQUAL( *element_i, first_element );
+ BOOST_CHECK_EQUAL( s0[*element_i], s1[*element_i] );
+ BOOST_CHECK_EQUAL( s1[*element_i], s2[*element_i] );
+ BOOST_CHECK_EQUAL( s0[*element_i], s2[*element_i] );
+ }
+ }
+}
+
+BOOST_AUTO_TEST_CASE( mussa_window_larger_than_sequence )
+{
+ string s0("AGCAGGG");
+ string s1("CAGCGGG");
+
+ Mussa analysis;
+ analysis.append_sequence(s0);
+ analysis.append_sequence(s1);
+ analysis.set_threshold(23);
+ analysis.set_window(30);
+ BOOST_CHECK_THROW(analysis.analyze(), seqcomp_error);
+}
+
+BOOST_AUTO_TEST_CASE( subanalysis )
+{
+ Sequence s1("AATGAAGATTTTAATGCTTTAATTTTGTTTTGTAAACTTCGAATTTCCAAAATTTGAAA");
+ Sequence s2("AGGAGCAAGTTCGCTTCATCGAGAATTTTTAATTTTTAGTCAAATTTTCCAATGTCTGA");
+
+ Mussa analysis;
+ analysis.append_sequence(s1);
+ analysis.append_sequence(s2);
+ analysis.set_threshold(8);
+ analysis.set_window(8);
+ analysis.analyze();
+
+ NwayPaths perfect_path = analysis.paths();
+ int perfect_match_count = perfect_path.pathz.size();
+
+ Sequence sub1 = s1.subseq(2, s1.size()-4);
+ Sequence sub2 = s2.subseq(2, s2.size()-4);
+ Mussa subanalysis;
+ subanalysis.append_sequence(sub1);
+ subanalysis.append_sequence(sub2);
+ subanalysis.set_threshold(7);
+ subanalysis.set_window(8);
+ subanalysis.analyze();
+ NwayPaths one_mismatch_path = subanalysis.paths();
+ int one_mismatch_count = one_mismatch_path.pathz.size();
+
+ BOOST_CHECK( perfect_match_count < one_mismatch_count );
+}
+
+BOOST_AUTO_TEST_CASE( dirty_flag )
+{
+ Mussa m;
+ BOOST_CHECK_EQUAL(m.is_dirty(), false);
+ m.set_name("foo");
+ BOOST_CHECK_EQUAL(m.is_dirty(), true);
+ m.clear();
+ m.set_window(30);
+ BOOST_CHECK_EQUAL(m.is_dirty(), true);
+ m.clear();
+ m.set_threshold(1);
+ BOOST_CHECK_EQUAL(m.is_dirty(), true);
+ m.clear();
+ m.set_soft_threshold(1);
+ BOOST_CHECK_EQUAL(m.is_dirty(), false);
+ m.clear();
+ m.append_sequence("AAGGCCTT");
+ BOOST_CHECK_EQUAL(m.is_dirty(), true);
+}
+