[mussa.git] / doc / manual / mussagl_manual.rst

==============
Mussagl Manual
==============
---------------
Brandon W. King
---------------

Last updated: Oct 18th, 2006

Updated to Mussagl build: (In process to 424)


.. Things to add
        * New features / change log
        * (DONE) Comment out anything isn't implemented yet.
        * (DONE) List of features that will be implemented in the future.
        * Look into the homology mapping of UCSC.
        * Add toggle to genomes.
        * Document why one fast record per region.
        * How to deal with the hazards of small utrs vis motif finder. (Add warning)
        * Add warning about saving FASTA file.
        * Add a general principles section near the top
                * Using comparison algorithm which will pickup all repeats
                * Add info about repeatmasking
                * Checking upstream and downstream genes for make sure you are in the right regions.
        * Later on: look into Ensembl
        * Look into method of homology instead of blating.
        * Mention advantages of using mupa.
        * Mention the difference between using arrows and scroll bar
        * Document the color for motifs
        * Update for Mac user left-click

        * Wormbase/Flybase/mirBASE tutorials



.. contents::

Status
======

Major New Features
------------------

 * Build 381
   * Analysis "Save As" feature

Change Log
----------

.. INSERT CHANGE LOG HERE
.. END INSERT CHANGE LOG

Features to be Implemented
--------------------------

For an up-to-date list of features to be implemented visit:
http://woldlab.caltech.edu/cgi-bin/mussa/roadmap

Introduction
============


What is Mussagl?
----------------

Mussa is an N-way version of the FamilyRelations (which is a part of
the Cartwheel project) 2-way comparative sequence analysis
software. Given DNA sequence from N species, Mussa uses all possible
pairwise comparions to derive an N-wise comparison. For example, given
sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
these comparisons, saving those that satisfy a transitivity
requirement. The saved paths are then displayed in an interactive
viewer.

Short History of Mussa
----------------------

Mussa Python/PMW Prototype
~~~~~~~~~~~~~~~~~~~~~~~~~~

First Python/PMW based protoype.

Mussa C++/FLTK
~~~~~~~~~~~~~~

A rewrite for speed purposes using C++ and FLTK GUI toolkit.

Mussagl C++/Qt/OpenGL
~~~~~~~~~~~~~~~~~~~~~

Refactored version using the more elegant Qt GUI framework and
OpenGL for hardware acceleration for those who have better graphics
cards.

Getting Mussagl
===============

License
-------

Mussagl has been released open source under the `GPL v2
license`__. 

__ GPL_

Platforms
---------

You have the option of building from source or downloading prebuilt
binaries. Most people will want the prebuilt versions.

Supported Platforms:
 
 * Mac OS X (binary or source)
 * Windows XP (binary or source)
 * Linux (source)

Download
--------

Mussagl in binary form for OS X and Windows and/or source can be
downloaded from http://mussa.caltech.edu/.

Install
-------

Mac OS X
~~~~~~~~
Once you have downloaded the .dmg file, double click on it and follow
the install instructions. 

FIXME: Mention how to launch the program.


Windows XP
~~~~~~~~~~
Once you have downloaded the Mussagl installer, double click on the
installer and follow the install instructions.

To start Mussagl, launch the program from Start > Programs > Mussagl >
Mussagl.


Linux
~~~~~
Currently we do not have a binary installer for Linux. You will have
to build from source. See the 'build from source' section below.


Build from Source
~~~~~~~~~~~~~~~~~

Instructions for building from source can be found `build page
<http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild>`_ on the
`Mussa wiki`__.

__ wiki_


Obtaining Input Data
====================

If you already have your data, you can skip ahead to the the `Using
Mussagl`_ section.

Let's say you have a gene of interest called 'SMN1' and you want to
know how the sequence surrounding the gene in multiple species is
conserved. Guess what, that's what we are going to do, retrieve the
DNA sequence for SMN1 and prepare it for using in Mussa.

For more information about SMN1 visit `NCBI's OMIM
<http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.

The SMN1 data retrieved in this section can be downloaded from the
`Mussa Example Data
<http://woldlab.caltech.edu/cgi-bin/mussa/wiki/ExampleData>`_ page if
you prefer to skip this section of the manual.


UCSC Genome Browser Method
--------------------------

There are many methods of retrieving DNA sequence, but for this
example we will retrieve SMN1 through the UCSC genome browser located
at http://genome.ucsc.edu/.


.. image:: images/ucsc_genome_browser_home.png
   :alt: UCSC Genome Browser
   :align: center

Step 1 - Find SMN1
~~~~~~~~~~~~~~~~~~

The first step in finding SMN1 is to use the **Gene Sorter** menu
option which I have highlighted in orange below:

.. image:: images/ucsc_menu_bar_gene_sorter.png
   :alt: Gene Sorter Menu Option
   :align: center

Gene Sorter page:

.. image:: images/ucsc_gene_sorter.png
   :alt: Gene Sorter
   :align: center

We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.

.. image:: images/ucsc_gs_sort_name_sim.png
   :alt: Gene Sorter - Name Similarity
   :align: center

After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.

.. image:: images/ucsc_gs_smn1.png
   :alt: Gene
   :align: center

Press **Go!** and you should see the following page:

.. image:: images/ucsc_gs_found.png
   :alt: Found SMN1
   :align: center

Click on **SMN1** and you will be taking the gene expression atlas
page.

.. image:: images/ucsc_gs_genome_position.png
   :alt: Gene expression atlas
   :align: center

Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
position column**.

Now we have found the location of SMN1 on human!

.. image:: images/ucsc_gb_smn1_human.png
   :alt: Genome Browser - SMN1 (human)
   :align: center


Step 2 - Download CDS/UTR sequence for annotations
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Since we have found **SMN1**, this would be a convenient time to extract
the DNA sequence for the CDS and UTRs of the gene to use it as an
annotation_ in Mussa.

**Click on SMN1** shown **between** the **two orange arrows** shown
below.

.. image:: images/ucsc_gb_smn1_human_click_smn1.png
   :alt: Genome Browser - SMN1 (human) - Orange Arrows
   :align: center

You should find yourself at the SMN1 description page.

.. image:: images/ucsc_gb_smn1_description_page.png
   :alt: Genome Browser - SMN1 (human) - Description page
   :align: center

**Scroll down** until you get to the **Sequence section** and click on
**Genomic (chr5:70,256,524-70,284,592)**.

.. image:: images/ucsc_gb_smn1_human_sequence.png
   :alt: Genome Browser - SMN1 (human) - Sequence
   :align: center

You should now be at the **Genomic sequence near gene** page:

.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
   :alt: Genome Browser - SMN1 (human) - Get genomic sequence
   :align: center

Make the following changes (highlighted in orange in the screenshot
below):

 1. UNcheck **introns**. 
    (We only want to annotate CDS and UTRs.)
 2. Select **one FASTA record** per **region**. 
    (Mussa needs each CDS and UTR represented by one FASTA record per CDS/UTR).
 3. Select **CDS in upper case, UTR in lower case.**

.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
   :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
   :align: center

Now click the **submit** button. You will then see a FASTA file with
many FASTA records representing the CDS and UTRS.

.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
   :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
   :align: center

Now you need to save the FASTA records to a **text file**. If you are
using **Firefox** or **Internet Explorer 6+** click on the **File >
Save As** menu option. 

**IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
repeat **NOT Webpage Complete** (see screenshot below.)

Type in **smn1_human_annot.txt** for the file name.

.. image:: images/smn1_human_annot.png
   :alt: Genome Browser - SMN1 (human) - sequence annotation file
   :align: center

**IMPORTANT:** You should open the file with a text editor and make
  sure **no HTML** was saved... If you find any HTML markup, delete
  the markup and save the file.

Now we are going to **modify the file** you just saved to **add the
name of the species** to the **annotation file**. All you have to do
is **add a new line** at the **top of the file** with the word **'Human'** as
shown below:

.. image:: images/smn1_human_annot_plus_human.png
   :alt: Genome Browser - SMN1 (human) - sequence annotation file
   :align: center

You can add more annotations to this file if you wish. See the
`annotation file format`_ section for details of the file format. By
including FASTA records in the annotation_ file, Mussa searches your
DNA sequence for an exact match of the sequence in the annotation_
file. If found, it will be marked as an annotation_ within Mussa.


Step 3 - Download gene and upstream/downstream sequence
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Use the back button in your web browser to get back the **genome
browser view** of **SMN1** as shown below.

.. image:: images/ucsc_gb_smn1_human.png
   :alt: Genome Browser - SMN1 (human)
   :align: center

There are two options for getting additional sequence around your
gene. The more complex way is to zoom out so that you have the
sequence you want being shown in the genome browser and then follow
the directions for the following method.

The second option, which we will choose, is to leave the genome
browser zoomed exactly at the location of SMN1 and click on the
**DNA** option on the menu bar (shown with orange arrows in the
screenshot below.)

.. image:: images/ucsc_gb_smn1_human_dna_option.png
   :alt: Genome Browser - SMN1 (human) - DNA Option
   :align: center

Now in the **get dna in window** page, let's add an arbitrary amount of
extra sequence on to each end of the gene, let's say 5000 base pairs.

.. image:: images/ucsc_gb_smn1_human_get_dna.png
   :alt: Genome Browser - SMN1 (human) - Get DNA 
   :align: center

Click the **get DNA** button.

.. image:: images/ucsc_gb_smn1_human_dna.png
   :alt: Genome Browser - SMN1 (human) - DNA 
   :align: center

Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
did in step 2 with the annotation file.

**IMPORTANT:** Make sure the file is saved as a text file and not an
HTML file. Open the file with a text editor and remove any HTML markup
you find.


Step 4 - Same/similar/related gene other species.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

What good is a multiple sequence alignment viewer without multiple
sequences? Let'S find a similar gene in a few more species.

Use the back button on your web browser until you get the **genome
browser view** of **SMN1** as shown below.

.. image:: images/ucsc_genome_browser_home.png
   :alt: UCSC Genome Browser
   :align: center

**Click on SMN1** shown **between** the **two orange arrows** shown
below.

.. image:: images/ucsc_gb_smn1_human_click_smn1.png
   :alt: Genome Browser - SMN1 (human) - Orange Arrows
   :align: center

You should find yourself at the SMN1 description page.

.. image:: images/ucsc_gb_smn1_description_page.png
   :alt: Genome Browser - SMN1 (human) - Description page
   :align: center

**Scroll down** until you get to the **Sequence section** and click on
**Protein (262 aa)**.

.. image:: images/ucsc_gb_smn1_human_sequence.png
   :alt: Genome Browser - SMN1 (human) - Sequence
   :align: center

Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
> Copy** option from the menu.

.. image:: images/smn1_human_protein.png
   :alt: Genome Browser - SMN1 (human) - Protein
   :align: center

Press the back button on the web browser once and then scroll to the
top of the page and click on the **BLAT** option on the menu bar
(shown below with orange arrows).

.. image:: images/ucsc_gb_smn1_human_blat.png
   :alt: Genome Browser - SMN1 (human) - Blat
   :align: center

**Paste** in the **protein sequence** and **change** the **genome** to
**mouse** as shown below and then click **submit**.

.. image:: images/ucsc_gb_smn1_human_blat_paste.png
   :alt: Genome Browser - SMN1 (human) - Blat paste protein
   :align: center

Notice that we have two hits, one of which looks pretty good at 89.9%
match.

.. image:: images/ucsc_gb_smn1_human_blat_hits.png
   :alt: Genome Browser - SMN1 (human) - Blat hits
   :align: center

**Click** on the **brower** link next to the 89.9% match. Notice in
the genome browser (shown below) that there is an annotated gene
called SMN1 for mouse which matches the line called **your sequence
from blat search**. This means we are fairly confidant we found the
right location in the mouse genome. 

.. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
   :alt: Genome Browser - SMN1 (human) - Blat to browser
   :align: center

Follow steps 1 through 3 for mouse and then repeat step 4 with the
human protein sequence to find **SMN1** in the following species (if
you find a match):

 1. Rat
 2. Rabbit
 3. Dog
 4. Armadillo
 5. Elephant
 6. Opposum
 7. x_tropicalis

Make sure to save the extended DNA sequence and annotation file for
each one.

Using Mussagl
=============


Launch Mussagl
--------------
Launch Mussagl... It should look similar to the screen shot below.

.. image:: images/opened.png
   :alt: Launch Mussa
   :align: center



Create/Load Analysis
----------------------

Currently there are three ways to load a Mussa experiment.

 1. `Create a new analysis`_
 2. `Load a mussa parameter file`_ (.mupa)
 3. `Load an analysis`_

.. _createnew:

Create a new analysis
~~~~~~~~~~~~~~~~~~~~~

To create a new analysis select 'Define analysis' from the 'File'
menu. You should see a dialog box similar to the one below. For this
demo we will use the example sequences that come with Mussagl.

.. image:: images/define_analysis.png
   :alt: Define Analysis
   :align: center

Instructions:

 1. **Give the experiment a name**, for this demo, we'll use
    'demo_w30_t20'. Mussa will create a folder with this name to store
    the analysis files in once it has been run.

 2. Choose a threshold_... for this demo **choose 20**. See the
    Threshold_ section for more detailed information.

 3. Choose a `window size`_. For this demo **choose 30**.


 4. Choose the number of sequences_ you would like. For this demo
    **choose 3**.

.. image:: images/define_analysis_step1a.png
   :alt: Steps 1-4
   :align: center

First enter the species name of "Human" in the first "Species" text
box. Now click on the 'Browse' button next to the sequence input box
and then select /examples/seq/human_mck_pro.fa file. Do the same in
the next two sequence input boxes selecting mouse_mck_pro.fa and
rabbit_mck_pro.fa as shown below. Make sure to give them a species
name as well. Note that you can create annotation files using the
mussa `Annotation File Format`_ to add annotations to your sequence.

.. image:: images/define_analysis_step2.png
   :alt: Choose sequences
   :align: center

Click the **create** button and in a few moments you should see
something similar to the following screen shot.

.. image:: images/demo.png
   :alt: Mussagl Demo
   :align: center

By default your analysis is NOT saved. If you try to close an analysis
without saving, you will be prompted with a dialog box asking you if
you would like to save your analysis. The `Saving`_ section for
details on saving your analysis. When saving, choose directory and
give the analysis the name **demo_w30_t20**. If you close and reopen
Mussagl, you will then be able to load the saved analysis. See `Load
an analysis`_ section below for details.


Load a mussa parameter file
~~~~~~~~~~~~~~~~~~~~~~~~~~~~

If you prefer, you can define your Mussa analysis using the Mussa
parameter file. See the `Parameter File Format`_ section for details
on creating a .mupa file.

Once you have a .mupa file created, load Mussagl and select the **File >
Create Analysis from File** menu option. Select the .mupa file and click
open. 

.. image:: images/load_mupa_menu.png
   :alt: Load Mussa Parameters
   :align: center

If you would like to see an example, you can load the
**mck3test.mupa** file in the examples directory that comes with
Mussagl.

.. image:: images/load_mupa_dialog.png
   :alt: Load Mussa Parameters Dialog
   :align: center


Load an analysis
~~~~~~~~~~~~~~~~

To load a previously run analysis open Mussagl and select the **File >
Open Existing Analysis** menu option. Select an analysis **directory** and
click open.

.. image:: images/load_analysis_menu.png
   :alt: Load Analysis Menu
   :align: center


Main Window
-----------

Overview
~~~~~~~~
.. Screen-shot with numbers showing features.

.. image:: images/window_overview.png
   :alt: Mussa Window
   :align: center

Legend:

 1. `DNA Sequence (Black bars)`_
 
 2. Annotation_

 3. Motif_

 4. `Red conservation tracks`_

 5. `Blue conservation tracks`_

 6. `Zoom Factor`_ (Base pairs per pixel)

 7. `Dynamic Threshold`_

 8. `Sequence Information Bar`_

 9. `Sequence Scroll Bar`_


DNA Sequence (black bars)
~~~~~~~~~~~~~~~~~~~~~~~~~

.. image:: images/sequence_bar.png
   :alt: Sequence Bar
   :align: center

Each of the black bars represents one of the loaded sequences, in this
case the sequence around the gene 'MCK' in human, mouse, and rabbit.


Annotation
~~~~~~~~~~

.. figure:: images/annotation.png
   :alt: Annotation
   :align: center
   
   Annotation shown in green on sequence bar.


Annotations can be included on any of the sequences using the `Load a
mussa parameter file`_ or `Create a new analysis`_ method of loading
your sequences. You can define annotations by location or using an
exact sub-sequence or a FASTA sequence of the section of DNA you wish
to annotate. See the `Annotation File Format`_ section for details.


Motif
~~~~~

.. figure:: images/motif.png
   :alt: Motif
   :align: center

   Motif shown in light blue on sequence bar.

The only real difference between an annotation and motif in Mussagl is
that you can define motifs and choose a color from within the GUI. See
the `Motifs`_ section for more information.


Red conservation tracks
~~~~~~~~~~~~~~~~~~~~~~~

.. figure:: images/conservation_tracks.png
   :alt: Conservation Tracks
   :align: center
   
   Conservations tracks shown as red and blue lines between sequence
   bars.

The **red lines** between the sequence bars represent conservation
between the sequences (i.e. not reverse complement matches)

The amount of sequence conservation shown will depend on how much your
sequences are related and the `dynamic threshold`_ you are using.


Blue conservation tracks
~~~~~~~~~~~~~~~~~~~~~~~~

.. figure:: images/conservation_tracks.png
   :alt: Conservation Tracks
   :align: center
   
   Conservations tracks shown as red and blue lines between sequence
   bars.

**Blue lines** represent **reverse complement** conservation relative
to the sequence attached to the top of the blue line.

The amount of sequence conservation shown will depend on how much your
sequences are related and the `dynamic threshold`_ you are using.


Zoom Factor
~~~~~~~~~~~

.. image:: images/zoom_factor.png
   :alt: Zoom Factor
   :align: center

The zoom factor represents the number of base pairs represented per
pixel. When you zoom in far enough the sequence will switch from
seeing a black bar, representing the sequence, to the actual sequence
(well, ASCII representation of sequence).


Dynamic Threshold
~~~~~~~~~~~~~~~~~

.. image:: images/dynamic_threshold.png
   :alt: Dynamic Threshold
   :align: center

You can dynamically change the threshold for how strong a match you
consider the conservation to be by changing the value in the dynamic
threshold box. 

The value you enter is the minimum number of base pairs that have to
be matched in order to be considered conserved. The second number that
you can't change is the `window size`_ you used when creating the
experiment. The last number is the percent match.

See the Threshold_ section for more information.


Sequence Information Bar
~~~~~~~~~~~~~~~~~~~~~~~~

.. image:: images/seq_info_bar.png
   :alt: Sequence Information Bar
   :align: center

The sequence information bars can be found to the left and right sides
of Mussagl. Next to each sequence you will find the following
information:

 1. Species (If it has been defined)
 2. Total Size of Sequence
 3. Current base pair position

Note that you can **update the species** text box. Make sure to **save your
experiment** after making this change by selecting **File > Save
Analysis** from the menu.

Sequence Scroll Bar
~~~~~~~~~~~~~~~~~~~

.. image:: images/scroll_bar.png
   :alt: Sequence Scroll Bar
   :align: center

The scroll bar allows you to scroll through the sequence which is
useful when you have zoomed in using the `zoom factor`_.


Saving
------

Save on Close
~~~~~~~~~~~~~

When ever you create a new analysis or make a change such as
adding/editing a motif or changing a species name, an asterisk (*)
will appear in the title of the window showing that there are changes
that have not been saved. If you close a Mussa window without saving
changes, Mussa will ask you if you would like to save the changes that
have been made.

Save Analysis
~~~~~~~~~~~~~

After making changes, such as updating species names or adding/editing
motifs, you can save these changes by selecting the **File > Save
analysis** menu option or pressing **CTRL + S** (PC) or
**Apple/Command Key + S** (on Mac).

.. image:: images/save_analysis.png
   :alt: Save analysis
   :align: center

Save Analysis As
~~~~~~~~~~~~~~~~

To save a copy of your analysis to a new location, select the **File >
Save analysis as** menu option and choose a new location and name for
your analysis.

.. image:: images/save_analysis_as.png
   :alt: Save analysis
   :align: center

Save Motif List
~~~~~~~~~~~~~~~

See `Save Motifs to File`_ in the `Motifs`_ section.


Annotations / Motifs
--------------------

Annotations
~~~~~~~~~~~

Currently annotations can be added to a sequence using the mussa
`annotation file format`_ and can be loaded by selecting the
annotation file when defining a new analysis (see `Create a new
analysis`_ section) or by defining a .mupa file pointing to your
annotation file (see `Load a mussa parameter file`_ section).

Motifs
~~~~~~

Load Motifs from File
*********************

It is possible to load motifs from a file which was saved from a
previous run or by defining your own motif file. See the `Motif File
Format`_ section for details.

NOTE: Valid motif list file extensions are:
  
  * .mtl
  * .txt

To load a motif file, select **Load Motif List** item from the
**File** menu and select a motif list file.

.. image:: images/load_motif.png
   :alt: Load Motif List
   :align: center


Save Motifs to File
*******************

Motifs from the `Motif Dialog`_ can be saved to file for use with
other analyses. If you just want your motifs to be saved with your
analysis, see the `save analysis`_ section for details.

To save a motif list, select **File > Save Motifs** menu option. By
default, Mussa will append .mtl if you do not provide a file extension
(valid file extensions: .mtl & .txt).

.. image:: images/save_motifs.png
   :alt: Save Motifs
   :align: center


Motif Dialog
************

Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
Code`_ for defining a motif. To define a motif, select **Edit > Edit
Motifs** menu item as shown below.

.. image:: images/view_edit_motifs.png
   :alt: "View > Edit Motifs" Menu
   :align: center

You will see a dialog box appear with a "apply" button in the bottom
right and one rows for defining motifs and the color that will be
displayed on the sequence. When you start adding your first motif, an
additional row will be added. The check box in the first column
defines whether the motif is displayed or not. The second column is
the motif display color. The third column is for the name of your
motif and finally, the fourth column is motif itself.

.. image:: images/motif_dialog_start.png
   :alt: Motif Dialog
   :align: center

Now let's make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
Code`_, type in **'ATSCT'** into the motif field and **'My Motif'** for
the name in the name field as shown below. 

Notice how a second row appeared when you started to add the first
motif. Every time you add a new motif, a new row will appear allowing
you to add as many motifs as you need.

.. image:: images/motif_dialog_enter_motif.png
   :alt: Enter Motif
   :align: center

Now choose a color for your motif by clicking on the colored area to
the left of the name field. Remember to choose a color that will show
up well with a black bar as the background. A good tool for picking a
color is the `Colour Contrast Analyser
<http://juicystudio.com/services/colourcontrast.php>`_ by
`juicystudio.com <http://juicystudio.com/>`_.

.. image:: images/color_chooser.png
   :alt: Color Chooser
   :align: center

Once you have selected the color for your motif, click on the
**'apply'** button. Notice that if Mussa finds matches to your motif
will now show up in the main Mussa window.

Before Motif:

.. image:: images/motif_dialog_bar_before.png
   :alt: Sequence bar before motif
   :align: center

After Motif:

.. image:: images/motif_dialog_bar_after.png
   :alt: Sequence bar after motif
   :align: center

To save your motifs with your analysis, see the `save analysis`_
section. To save your motifs to a file, see the `save motifs to file`_
section.


View Mussa Alignments
---------------------

Mussagl allows you to zoom in on Mussa alignments by selecting the set
of alignment(s) of interest. To do this, move the mouse near the
alignment you are interested in viewing and then **PRESS** and
**HOLD** the **LEFT mouse button** and **drag the mouse** to the other
side of the conservation track so that you see a bounding box
overlaping the alienment(s) of interest and then **let go** of the
*left mouse button*.

In the example below, I started by left-clicking on the area marked by
a red dot (upper left corner of bounding box) and dragging the mouse to
the area marked by a blue dot (lower right corner of the bounding box)
and letting go of the left mouse button.

.. image:: images/select_sequence.png
   :alt: Select Sequence
   :align: center

All of the lines which were not selected should be washed out as shown
below:

.. image:: images/washed_out.png
   :alt: Tracks washed out
   :align: center

With a selection made, goto the **View** menu and select **View mussa alignment**.

.. image:: images/view_mussa_alignment.png
   :alt: View mussa alignment
   :align: center

You should see the alignment at the base-pair level as shown below.

.. image:: images/mussa_alignment.png
   :alt: Mussa alignment
   :align: center


Sub-analysis
------------

To run a sub-analysis **highlight** a section of sequence and *right
click* on it and select **Add to subanalysis**. To the same for the
sequences shown in orange in the screenshot below. Note that you **are
NOT limited** to selecting more than one subsequence from the same
sequence.

.. image:: images/subanalysis_select_seqs.png
   :alt: Subanalysis sequence selection
   :align: center

Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.

.. image:: images/subanalysis_dialog.png
   :alt: Subanalysis Dialog
   :align: center

A new Mussa window will appear with the subanalysis of your sequences
once it's done running. This may take a while if you selected large
chunks of sequence with a loose threshold.

.. image:: images/subanalysis_done.png
   :alt: Subalaysis complete
   :align: center


Copying sequence to clipboard
-----------------------------

To copy a sequence to the clipboard, highlight a section of sequence,
as shown in the screen shot below, and do one of the following:

 * Select **Copy as FASTA** from the **Edit** menu.
 * **Right-Click (Left-click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as FASTA**.
 * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.

.. image:: images/copy_sequence.png
   :alt: Copy sequence
   :align: center

Saving to an Image
---------------------------------

 * Updated to build 419.

To save your current mussa view to an image, select **File > Save to
image...** as shown below.

.. image:: images/save_to_image_menu.png
   :alt: File > Save to image...
   :align: center

You can define the width and the height of the image to save. By
default it will use the same size of your current view. Since the
Mussa view is implemented using vectors, if you choose a larger size
then your current view, Mussa will redraw at the higher resolution
when saving. In other words, you get higher quality images when saving
at a higher resolution.

If you check the "Lock aspect ratio" check box, which I have circled
in red, then when you change one value, say width, the other, height,
will update automatically to keep the same aspect ratio.

.. image:: images/save_to_image_dialog.png
   :alt: Save to image dialog
   :align: center

Click save and choose a location and filename for your file.

The valid image formats are:

  * .png (default if no extension specified.)
  * .jpg


Detailed Information
--------------------

Threshold
~~~~~~~~~

The threshold of an analysis is in minimum number of base pair matches
must be meet to in order to be kept as a match. Note that you can vary
the threshold from within Mussagl. For example, if you choose a
`window size`_ of **30** and a **threshold** of **20** the mussa nway
transitive algorithm will store all matches that are 20 out of 30 bp
matches or better and pass it on to Mussagl. Mussagl will then allow
you to dynamically choose a threshold from 20 to 30 base pairs. A
threshold of 30 bps would only show 30 out of 30 bp matches. A
threshold of 20 bps would show all matches of 20 out of 30 bps or
better. If you would like to see results for matches lower than 20 out
of 30, you will need to rerun the analysis with a lower threshold.

Window Size
~~~~~~~~~~~

The typical sizes people tend to choose are between 20 and 30. You
will likely need to experiment with this setting depending on your
needs and input sequence.


Sequences
~~~~~~~~~

Mussa reads in sequences which are formatted in the FASTA_
format. Mussa may take a long time to run (>10 minutes) if the total
bp length near 280Kb. Once mussa has run once, you can reload
previously run analyzes.

FIXME: We have learned more about how much sequence and how many to
put in Mussagl, this information should be documented here.


Mussa File Formats
------------------

.. _param:

Parameter File Format
~~~~~~~~~~~~~~~~~~~~~

**File Format (.mupa):**

::

  # name of analysis directory and stem for associated files
  ANA_NAME <analysis_name>
  
  # if APPEND vars true, a _wXX and/or _tYY added to analysis name
  # where XX = WINDOW and YY = THRESHOLD
  # Highly recommeded with use of command line override of WINDOW or THRESHOLD
  APPEND_WIN <true/false>
  APPEND_THRES <true/false>
  
  # how many sequences are being analyzed
  SEQUENCE_NUM <num>
  
  # first sequence info
  SEQUENCE <FASTA_file_path>
  ANNOTATION <annotation_file_path>
  SEQ_START <sequence_start>
  
  # the second sequence info
  SEQUENCE <FASTA_file_path>
  # ANNOTATION <annotation_file_path>
  SEQ_START <sequence_start>
  # SEQ_END <sequence_end>

  # third sequence info
  SEQUENCE <FASTA_file_path>
  # ANNOTATION <annotation_file_path>
  
  # analyzes parameters: command line args -w -t will override these
  WINDOW <num>
  THRESHOLD <num>

.. csv-table:: Parameter File Options:
   :header: "Option Name", "Value", "Default", "Required", "Description"
   :widths: 30 30 30 30 60

   "ANA_NAME", "string", "N/A", "true", "Name of analysis (Also
   name of directory where analysis will be saved." 
   "APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
   "APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
   "SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
   to analyze" 
   "SEQUENCE", "/FASTA/filepath.fa", "N/A", "true", "Must define one
   sequence per SEQUENCE_NUM." 
   "ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
   annotation file. See `annotation file format`_ section for more
   information." 
   "SEQ_START", "integer", "1", "false", "Optional index into FASTA file"
   "SEQ_END", "integer", "1", "false", "Optional index into FASTA file"
   "WINDOW", "integer", "N/A", "true", "`Window Size`_"
   "THRESHOLD", "integer", "N/A", "true", "`Threshold`_"

.. _annot:

Annotation File Format
~~~~~~~~~~~~~~~~~~~~~~

The first line in the file is the sequence name. Each line there after
is a **space** separated annotation. 

New as of build 198:
 
 * The annotation format now supports FASTA sequences embedded in the
   annotation file as shown in the format example below. Mussagl will
   take this sequence and look for an exact match of this sequence in
   your sequences. If a match is found, it will label it with the name 
   of from the FASTA header.

Format:

::
  
  <species/sequence_name>
  <start> <stop> <annotation_name> <annotation_type>
  <start> <stop> <annotation_name> <annotation_type>
  <start> <stop> <annotation_name> <annotation_type>
  <start> <stop> <annotation_name> <annotation_type>
  >FASTA Header
  ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
  ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
  TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
  ACGTACGGCAGTACGCGGTCAGA
  <start> <stop> <annotation_name> <annotation_type>
  ...

Example:

::

  Mouse
  251 500 Glorp Glorptype
  751 1000 Glorp Glorptype
  1251 1500 Glorp Glorptype
  >My favorite DNA sequence
  GATTACA
  1751 2000 Glorp Glorptype


.. _motif_file_format:

Motif File Format
~~~~~~~~~~~~~~~~~

Format:

  <motif> <red> <green> <blue>
  
Example:

  GGCC 0.0 1 1



IUPAC Nucleotide Code
~~~~~~~~~~~~~~~~~~~~~~

For your convenience, below is a table of the IUPAC Nucleotide Code.

The following table is table 1 from "Nomenclature for Incompletely
Specified Bases in Nucleic Acid Sequences" which can be found at
http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.

======  =================  ===================================
Symbol  Meaning            Origin of designation
======  =================  ===================================
G       G                  Guanine
A       A                  Adenine
T       T                  Thymine
C       C                  Cytosine
R       G or A             puRine
Y       T or C             pYrimidine
M       A or C             aMino
K       G or T             Keto
S       G or C             Strong interaction (3 H bonds)
W       A or T             Weak interaction (2 H bonds)
H       A or C or T        not-G, H follows G in the alphabet
B       G or T or C        not-A, B follows A
V       G or C or A        not-T (not-U), V follows U
D       G or A or T        not-C, D follows C
N       G or A or T or C   aNy
======  =================  ===================================


.. Define links below
   ------------------

.. _GPL: http://www.opensource.org/licenses/gpl-license.php
.. _wiki: http://mussa.caltech.edu
.. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
.. _FASTA: http://en.wikipedia.org/wiki/fasta_format
.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif