8 Last updated: July 7th, 2006
10 Updated to Mussagl build: 287
14 * New features / change log
15 * Comment out anything isn't implemented yet.
16 * List of features that will be implemented in the future.
17 * Look into the homology mapping of UCSC.
18 * Add toggle to genomes.
19 * Document why one fast record per region.
20 * How to deal with the hazards of small utrs vis motif finder. (Add warning)
21 * Add warning about saving fasta file.
22 * Add a general principles section near the top
23 * Using comparison algorithm which will pickup all repeats
24 * Add info about repeatmasking
25 * Checking upstream and downstream genes for make sure you are in the right regions.
26 * Later on: look into Ensembl
27 * Look into method of homology instead of blating.
28 * Mention advantages of using mupa.
29 * Mention the difference between using arrows and scroll bar
30 * Document the color for motifs
31 * Update for Mac user left click
33 * Wormbase/Flybase/mirBASE
46 Mussa is an N-way version of the FamilyRelations (which is a part of
47 the Cartwheel project) 2-way comparative sequence analysis
48 software. Given DNA sequence from N species, Mussa uses all possible
49 pairwise comparions to derive an N-wise comparison. For example, given
50 sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
51 1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
52 these comparisons, saving those that satisfy a transitivity
53 requirement. The saved paths are then displayed in an interactive
56 Short History of Mussa
57 ----------------------
60 Mussa Python/PMW Prototype
61 ~~~~~~~~~~~~~~~~~~~~~~~~~~
63 First Python/PMW based protoype.
68 A rewrite for speed purposes using C++ and FLTK GUI toolkit.
73 Refactored version using the more elegant Qt GUI framework and
74 OpenGL for hardware acceleration for those who have beter graphics
83 Mussagl has been released open source under the `GPL v2
91 You have the option of building from source or downloading prebuilt
92 binaries. Most people will want the prebuilt versions.
96 * Mac OS X (binary or source)
97 * Windows XP (binary or source)
103 Mussagl in binary form for OS X and Windows and/or source can be
104 downloaded from http://mussa.caltech.edu/.
111 Once you have downloaded the .dmg file, double click on it and follow
112 the install instructions.
114 FIXME: Mention how to launch the program.
119 Once you have downloaded the Mussagl installer, double click on the
120 installer and follow the install instructions.
122 To start Mussagl, launch the program from Start > Programs > Mussagl >
128 Currently we do not have a binary installer for Linux. You will have
129 to build from source. See the 'build from source' section below.
135 Instructions for building from source can be found `build page
136 <http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild>`_ on the
145 If you already have your data, you can skip ahead to the the `Using
148 Lets say you have a gene of interest called 'SMN1' and you want to
149 know how the sequence surrounding the gene in multiple species is
150 conserved. Guess what, that's what we are going to do, retrieve the
151 DNA sequence for SMN1 and prepare it for using in Mussa.
153 For more information about SMN1 visit `NCBI's OMIM
154 <http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
156 UCSC Genome Browser Method
157 --------------------------
159 There are many methods of retrieving DNA sequence, but for this
160 example we will retrieve SMN1 through the UCSC genome broswer located
161 at http://genome.ucsc.edu/.
163 .. image:: images/ucsc_genome_browser_home.png
164 :alt: UCSC Genome Broswer
170 The first step in finding SMN1 is to use the **Gene Sorter** menu
171 option which I have highlighted in orange below:
173 .. image:: images/ucsc_menu_bar_gene_sorter.png
174 :alt: Gene Sorter Menu Option
179 .. image:: images/ucsc_gene_sorter.png
183 We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
185 .. image:: images/ucsc_gs_sort_name_sim.png
186 :alt: Gene Sorter - Name Similarity
189 After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
191 .. image:: images/ucsc_gs_smn1.png
195 Press **Go!** and you should see the following page:
197 .. image:: images/ucsc_gs_found.png
201 Click on **SMN1** and you will be taking the gene expression atlas
204 .. image:: images/ucsc_gs_genome_position.png
205 :alt: Gene expression atlas
208 Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
211 Now we have found the location of SMN1 on human!
213 .. image:: images/ucsc_gb_smn1_human.png
214 :alt: Genome Browser - SMN1 (human)
218 Step 2 - Download CDS/UTR sequence for annotations
219 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
221 Since we have found **SMN1**, this would be a convient time to extract
222 the DNA sequence for the CDS and UTRs of the gene to use it as an
223 annotation_ in Mussa.
225 **Click on SMN1** shown **between** the **two orange arrows** shown
228 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
229 :alt: Genome Browser - SMN1 (human) - Orange Arrows
232 You should find yourself at the SMN1 description page.
234 .. image:: images/ucsc_gb_smn1_description_page.png
235 :alt: Genome Browser - SMN1 (human) - Description page
238 **Scroll down** until you get to the **Sequence section** and click on
239 **Genomic (chr5:70,256,524-70,284,592)**.
241 .. image:: images/ucsc_gb_smn1_human_sequence.png
242 :alt: Genome Browser - SMN1 (human) - Sequence
245 You should now be at the **Genomic sequence near gene** page:
247 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
248 :alt: Genome Browser - SMN1 (human) - Get genomic sequence
251 Make the following changes (highlighted in orange in the screenshot
254 1. UNcheck **introns**.
255 (We only want to annotate CDS and UTRs.)
256 2. Select **one fasta record** per **region**.
257 (Mussa needs each CDS and UTR represented by one fasta record per CDS/UTR).
258 3. Select **CDS in upper case, UTR in lower case.**
260 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
261 :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
264 Now click the **submit** button. You will then see a fasta file with
265 many fasta records representing the CDS and UTRS.
267 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
268 :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
271 Now you need to save the fasta records to a **text file**. If you are
272 using **Firefox** or **Internet Explorer 6+** click on the **File >
273 Save As** menu option.
275 **IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
276 repeat **NOT Webpage Complete** (see screenshot below.)
278 Type in **smn1_human_annot.txt** for the file name.
280 .. image:: images/smn1_human_annot.png
281 :alt: Genome Browser - SMN1 (human) - sequence annotation file
284 **IMPORTANT:** You should open the file with a text editor and make
285 sure **no html** was saved... If you find any html markup, delete
286 the markup and save the file.
288 Now we are going to **modify the file** you just saved to **add the
289 name of the species** to the **annotation file**. All you have to do
290 is **add a new line** at the **top of the file** with the word **'Human'** as
293 .. image:: images/smn1_human_annot_plus_human.png
294 :alt: Genome Browser - SMN1 (human) - sequence annotation file
297 You can add more annotations to this file if you wish. See the
298 `annotation file format`_ section for details of the file format. By
299 including fasta records in the annotation_ file, Mussa searches your
300 DNA sequence for an exact match of the sequence in the annotation_
301 file. If found, it will be marked as an annotation_ within Mussa.
304 Step 3 - Download gene and upstream/downstream sequence
305 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
307 Use the back button in your web browser to get back the **genome
308 browser view** of **SMN1** as shown below.
310 .. image:: images/ucsc_gb_smn1_human.png
311 :alt: Genome Browser - SMN1 (human)
314 There are two options for getting additional sequence around your
315 gene. The more complex way is to zoom out so that you have the
316 sequence you want being shown in the genome browser and then follow
317 the directions for the following method.
319 The second option, which we will choose, is to leave the genome
320 browser zoomed exactly at the location of SMN1 and click on the
321 **DNA** option on the menu bar (shown with orange arrows in the
324 .. image:: images/ucsc_gb_smn1_human_dna_option.png
325 :alt: Genome Browser - SMN1 (human) - DNA Option
328 Now in the **get dna in window** page, lets add an arbitrary amount of
329 extra sequence on to each end of the gene, lets say 5000 base pairs.
331 .. image:: images/ucsc_gb_smn1_human_get_dna.png
332 :alt: Genome Browser - SMN1 (human) - Get DNA
335 Click the **get DNA** button.
337 .. image:: images/ucsc_gb_smn1_human_dna.png
338 :alt: Genome Browser - SMN1 (human) - DNA
341 Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
342 did in step 2 with the annotation file.
344 **IMPORTANT:** Make sure the file is saved as a text file and not an
345 HTML file. Open the file with a text editor and remove any HTML markup
349 Step 4 - Same/similar/related gene other species.
350 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
352 What good is a multiple sequence alignment viewer without multiple
353 sequences? Lets find a similar gene in a few more species.
355 Use the back button on your web browser until you get the **genome
356 broswer view** of **SMN1** as shown below.
358 .. image:: images/ucsc_genome_browser_home.png
359 :alt: UCSC Genome Broswer
362 **Click on SMN1** shown **between** the **two orange arrows** shown
365 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
366 :alt: Genome Browser - SMN1 (human) - Orange Arrows
369 You should find yourself at the SMN1 description page.
371 .. image:: images/ucsc_gb_smn1_description_page.png
372 :alt: Genome Browser - SMN1 (human) - Description page
375 **Scroll down** until you get to the **Sequence section** and click on
376 **Protein (262 aa)**.
378 .. image:: images/ucsc_gb_smn1_human_sequence.png
379 :alt: Genome Browser - SMN1 (human) - Sequence
382 Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
383 > Copy** option from the menu.
385 .. image:: images/smn1_human_protein.png
386 :alt: Genome Browser - SMN1 (human) - Protein
389 Press the back button on the web browser once and then scroll to the
390 top of the page and click on the **BLAT** option on the menu bar
391 (shown below with orange arrows).
393 .. image:: images/ucsc_gb_smn1_human_blat.png
394 :alt: Genome Browser - SMN1 (human) - Blat
397 **Paste** in the **protein sequence** and **change** the **genome** to
398 **mouse** as shown below and then click **submit**.
400 .. image:: images/ucsc_gb_smn1_human_blat_paste.png
401 :alt: Genome Browser - SMN1 (human) - Blat paste protein
404 Notice that we have two hits, one of which looks pretty good at 89.9%
407 .. image:: images/ucsc_gb_smn1_human_blat_hits.png
408 :alt: Genome Browser - SMN1 (human) - Blat hits
411 **Click** on the **brower** link next to the 89.9% match. Notice in
412 the genome browser (shown below) that there is an annotated gene
413 called SMN1 for mouse which matches the line called **your sequence
414 from blat search**. This means we are fairly confidant we found the
415 right location in the mouse genome.
417 .. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
418 :alt: Genome Browser - SMN1 (human) - Blat to browser
421 Follow steps 1 through 3 for mouse and then repeat step 4 with the
422 human protein sequence to find **SMN1** in the following species (if
433 Make sure to save the extended DNA sequence and annotation file for
442 Launch Mussagl... It should look similar to the screen shot below.
444 .. image:: images/opened.png
451 ----------------------
453 Currently there are three ways to load a Mussa experiment.
455 1. `Create a new analysis`_
456 2. `Load a mussa parameter file`_ (.mupa)
457 3. `Load an analysis`_
461 Create a new analysis
462 ~~~~~~~~~~~~~~~~~~~~~
464 To create a new analysis select 'Define analysis' from the 'File'
465 menu. You should see a dialog box similar to the one below. For this
466 demo we will use the example sequences that come with Mussagl.
468 .. image:: images/define_analysis.png
469 :alt: Define Analysis
474 1. **Give the experiment a name**, for this demo, we'll use
475 'demo_w30_t20'. Mussa will create a folder with this name to store
476 the analysis files in once it has been run.
478 2. Choose a `window size`_. For this demo **choose 30**.
480 3. Choose a threshold_... for this demo **choose 20**. See the
481 Threshold_ section for more detailed information.
483 4. Choose the number of sequences_ you would like. For this demo
486 .. image:: images/define_analysis_step1a.png
490 Now click on the 'Browse' button next to the sequence input box and
491 then select /examples/seq/human_mck_pro.fa file. Do the same in the
492 next two sequence input boxes selecting mouse_mck_pro.fa and
493 rabbit_mck_pro.fa as shown below. Note that you can create annotation
494 files using the mussa `Annotation File Format`_ to add annotations to
497 .. image:: images/define_analysis_step2.png
498 :alt: Choose sequences
501 Click the **create** button and in a few moments you should see
502 something similar to the following screen shot.
504 .. image:: images/demo.png
508 This analysis is now saved in a directory called **demo_w30_t20** in
509 the current working directory. If you close and reopen Mussagl, you
510 can reload the saved analysis. See `Load an analysis`_ section below
514 Load a mussa parameter file
515 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~
517 If you prefer, you can define your Mussa analysis using the Mussa
518 parameter file. See the `Parameter File Format`_ section for details
519 on creating a .mupa file.
521 Once you have a .mupa file created, load Mussagl and select the **File >
522 Load Mussa Parameters** menu option. Select the .mupa file and click
525 .. image:: images/load_mupa_menu.png
526 :alt: Load Mussa Parameters
529 If you would like to see an example, you can load the
530 **mck3test.mupa** file in the examples directory that comes with
533 .. image:: images/load_mupa_dialog.png
534 :alt: Load Mussa Parameters Dialog
541 To load a previously run analysis open Mussagl and select the **File >
542 Load Analysis** menu option. Select an analysis **directory** and
545 .. image:: images/load_analysis_menu.png
546 :alt: Load Analysis Menu
555 .. Screen-shot with numbers showing features.
557 .. image:: images/window_overview.png
563 1. `DNA Sequence (Black bars)`_
569 4. `Conservation tracks`_
573 6. `Zoom Factor`_ (Base pairs per pixel)
575 7. `Dynamic Threshold`_
577 8. `Sequence Information Bar`_
579 9. `Sequence Scroll Bar`_
582 DNA Sequence (black bars)
583 ~~~~~~~~~~~~~~~~~~~~~~~~~
585 .. image:: images/sequence_bar.png
589 Each of the black bars represents one of the loaded sequences, in this
590 case the sequence around the gene 'MCK' in human, mouse, and rabbit.
592 FIXME: Should I mention the repeats here?
598 .. figure:: images/annotation.png
602 Annotation shown in green on sequence bar.
605 Annotations can be included on any of the sequences using the `Load a
606 mussa parameter file`_ method of loading your sequences. You can
607 define annotations by location or using an exact sub-sequence and you
608 may also choose any color for display of the annotation; see the
609 `Annotation File Format`_ section for details.
611 Note: Currently there is no way to add annotations using the GUI (only
612 via the .mupa file). We plan to add this feature in the future, but it
613 likely will not make it into the first release.
619 .. figure:: images/motif.png
623 Motif shown in light blue on sequence bar.
625 The only real difference between an annotation and motif in Mussagl is
626 that you can define motifs from within the GUI. See the `Motifs`_
627 section for more information.
633 .. figure:: images/conservation_tracks.png
634 :alt: Conservation Tracks
637 Conservations tracks shown as red and blue lines between sequence
640 The **red lines** between the sequence bars represent conservation
641 between the sequences and **blue lines** represent **reverse
642 complement** conservation. The amount of sequence conservation shown
643 will depend on the relatedness of your sequences and the `dynamic
644 threshold` you are using. Sequences with lots of repeats will cause
645 major slow downs in calculating the matches.
651 .. image:: images/motif_toggle.png
655 Toggles motifs on and off. This will not turn on and off annotations.
657 Note: As of the current build (#200), this feature hasn't been
664 .. image:: images/zoom_factor.png
668 The zoom factor represents the number of base pairs represented per
669 pixel. When you zoom in far enough the sequence will switch from
670 seeing a black bar, representing the sequence, to the actual sequence
671 (well, ASCII representation of sequence).
677 .. image:: images/dynamic_threshold.png
678 :alt: Dynamic Threshold
681 You can dynamically change the threshold for how strong of match you
682 consider the conservation to be with one of two options:
684 1. Number of base pair matches out of window size.
686 2. Percent base pair conservation.
688 See the Threshold_ section for more information.
691 Sequence Information Bar
692 ~~~~~~~~~~~~~~~~~~~~~~~~
694 .. image:: images/seq_info_bar.png
695 :alt: Sequence Information Bar
698 The sequence information bars can be found to the left and right sides
699 of Mussagl. Next to each sequence you will find the following
702 1. Species (If it has been defined)
703 2. Total Size of Sequence
704 3. Current base pair position
710 .. image:: images/scroll_bar.png
711 :alt: Sequence Scroll Bar
714 The scroll bar allows you to scroll through the sequence which is
715 useful when you have zoomed in using the `zoom factor`_.
724 Currently annotations can be added to a sequence using the mussa
725 `annotation file format`_ and can be loaded by selecting the
726 annotation file when defining a new analysis (see `Create a new
727 analysis`_ section) or by defining a .mupa file pointing to your
728 annotation file (see `Load a mussa parameter file`_ section).
733 Load Motifs from File
734 *********************
736 It is possible to load motifs from a file which was saved from a
737 previous run or by defining your own motif file. See the `Motif File
738 Format`_ section for details.
740 To load a motif file, select **Load Motif List** item from the
741 **File** menu and select a motif list file.
743 .. image:: images/load_motif.png
744 :alt: Load Motif List
751 Note: Currently not implemented
760 * Allow for toggling individual motifs on and off.
763 * Field added for naming motifs.
765 Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
766 Code`_ for defining a motif. To define a motif, select **Edit > Edit
767 Motifs** menu item as shown below.
769 .. image:: images/view_edit_motifs.png
770 :alt: "View > Edit Motifs" Menu
773 You will see a dialog box appear with a "set motifs" button and 10
774 rows for defining motifs and the color that will be displayed on the
775 sequence. By default all 10 motifs start off as with white as the
776 color. In the image below, I changed the color from white to blue to
777 make it easier to see. The first text box is for the motif and the
778 second box is for the name of the motif. The check box defines whether
779 the motif is displayed or not.
781 .. image:: images/motif_dialog_start.png
785 Now lets make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
786 Code`_, type in **'ATSCT'** into the first box and 'My Motif' for the
787 name in the second box as shown below.
789 .. image:: images/motif_dialog_enter_motif.png
793 Now choose a color for your motif by clicking on the colored area to
794 the left of the motif. In the image above, you would click on the blue
795 square, but by default the squares will be white. Remember to choose a
796 color that will show up well with a black bar as the background.
798 .. image:: images/color_chooser.png
802 Once you have selected the color for your motif, click on the 'set
803 motifs' button. Notice that if Mussa finds matches to your motif will
804 now show up in the main Mussagl window.
808 .. image:: images/motif_dialog_bar_before.png
809 :alt: Sequence bar before motif
814 .. image:: images/motif_dialog_bar_after.png
815 :alt: Sequence bar after motif
819 View Mussa Alignements
820 ----------------------
822 Mussagl allows you to zoom in on Mussa alignments by selecting the set
823 of alignment(s) of interest. To do this, move the mouse near the
824 alignment you are interested in viewing and then **PRESS** and
825 **HOLD** the **LEFT mouse button** and **drag the mouse** to the other
826 side of the conservation track so that you see a bounding box
827 overlaping the alienment(s) of interest and then **let go** of the
830 In the example below, I started by left clicking on the area marked by
831 a red dot (upper left corner of bounding box) and draging the mouse to
832 the area marked by a blue dot (lower right corner of the bounding box)
833 and letting go of the left mouse button.
835 .. image:: images/select_sequence.png
836 :alt: Select Sequence
839 All of the lines which were not selected should be washed out as shown
842 .. image:: images/washed_out.png
843 :alt: Tracks washed out
846 With a selection made, goto the **View** menu and select **View mussa alignment**.
848 .. image:: images/view_mussa_alignment.png
849 :alt: View mussa alignment
852 You should see the alignment at the base-pair level as shown below.
854 .. image:: images/mussa_alignment.png
855 :alt: Mussa alignment
862 To run a sub-analysis **highlight** a section of sequence and *right
863 click* on it and select **Add to subanalysis**. To the same for the
864 sequences shown in orange in the screenshot below. Note that you **are
865 NOT limited** to selecting more than one subsequence from the same
868 .. image:: images/subanalysis_select_seqs.png
869 :alt: Subanalysis sequence selection
872 Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
874 .. image:: images/subanalysis_dialog.png
875 :alt: Subanalysis Dialog
878 A new Mussa window will appear with the subanalysis of your sequences
879 once it's done running. This may take a while if you selected large
880 chunks of sequence with a loose threshold.
882 .. image:: images/subanalysis_done.png
883 :alt: Subalaysis complete
887 Copying sequence to clipboard
888 -----------------------------
890 To copy a sequence to the clipboard, highlight a section of sequence,
891 as shown in the screen shot below, and do one of the following:
893 * Select **Copy as Fasta** from the **Edit** menu.
894 * **Right Click (Left click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as Fasta**.
895 * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
897 .. image:: images/copy_sequence.png
902 ---------------------------------
904 FIXME: Need to write this section
913 The threshold of an analysis is in minimum number of base pair matches
914 must be meet to in order to be kept as a match. Note that you can vary
915 the threshold from within Mussagl. For example, if you choose a
916 `window size`_ of **30** and a **threshold** of **20** the mussa nway
917 transitive algorithm will store all matches that are 20 out of 30 bp
918 matches or better and pass it on to Mussagl. Mussagl will then allow
919 you to dynamically choose a threshold from 20 to 30 base pairs. A
920 threshold of 30 bps would only show 30 out of 30 bp matches. A
921 threshold of 20 bps would show all matches of 20 out of 30 bps or
922 better. If you would like to see results for matches lower than 20 out
923 of 30, you will need to rerun the analysis with a lower threshold.
928 The typical sizes people tend to choose are between 20 and 30. You
929 will likely need to experiment with this setting depending on your
930 needs and input sequence.
936 Mussa reads in sequences which are formatted in the fasta_
937 format. Mussa may take a long time to run (>10 minutes) if the total
938 bp length near 280Kb. Once mussa has run once, you can reload
939 previously run analyzes.
941 FIXME: We have learned more about how much sequence and how many to
942 put in Mussagl, this information should be documented here.
950 Parameter File Format
951 ~~~~~~~~~~~~~~~~~~~~~
953 **File Format (.mupa):**
957 # name of analysis directory and stem for associated files
958 ANA_NAME <analysis_name>
960 # if APPEND vars true, a _wXX and/or _tYY added to analysis name
961 # where XX = WINDOW and YY = THRESHOLD
962 # Highly recommeded with use of command line override of WINDOW or THRESHOLD
963 APPEND_WIN <true/false>
964 APPEND_THRES <true/false>
966 # how many sequences are being analyzed
969 # first sequence info
970 SEQUENCE <fasta_file_path>
971 ANNOTATION <annotation_file_path>
972 SEQ_START <sequence_start>
974 # the second sequence info
975 SEQUENCE <fasta_file_path>
976 # ANNOTATION <annotation_file_path>
977 SEQ_START <sequence_start>
978 # SEQ_END <sequence_end>
980 # third sequence info
981 SEQUENCE <fasta_file_path>
982 # ANNOTATION <annotation_file_path>
984 # analyzes parameters: command line args -w -t will override these
988 .. csv-table:: Parameter File Options:
989 :header: "Option Name", "Value", "Default", "Required", "Description"
990 :widths: 30 30 30 30 60
992 "ANA_NAME", "string", "N/A", "true", "Name of analysis (Also
993 name of directory where analysis will be saved."
994 "APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
995 "APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
996 "SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
998 "SEQUENCE", "/fasta/filepath.fa", "N/A", "true", "Must define one
999 sequence per SEQUENCE_NUM."
1000 "ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
1001 annotation file. See `annotation file format`_ section for more
1003 "SEQ_START", "integer", "1", "false", "Optional index into fasta file"
1004 "SEQ_END", "integer", "1", "false", "Optional index into fasta file"
1005 "WINDOW", "integer", "N/A", "true", "`Window Size`_"
1006 "THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
1010 Annotation File Format
1011 ~~~~~~~~~~~~~~~~~~~~~~
1013 The first line in the file is the sequence name. Each line there after
1014 is a **space** separated annotation.
1016 New as of build 198:
1018 * The annotation format now supports fasta sequences embedded in the
1019 annotation file as shown in the format example below. Mussagl will
1020 take this sequence and look for an exact match of this sequence in
1021 your sequences. If a match is found, it will label it with the name
1022 of from the fasta header.
1028 <species/sequence_name>
1029 <start> <stop> <annotation_name> <annotation_type>
1030 <start> <stop> <annotation_name> <annotation_type>
1031 <start> <stop> <annotation_name> <annotation_type>
1032 <start> <stop> <annotation_name> <annotation_type>
1034 ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
1035 ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
1036 TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
1037 ACGTACGGCAGTACGCGGTCAGA
1038 <start> <stop> <annotation_name> <annotation_type>
1046 251 500 Glorp Glorptype
1047 751 1000 Glorp Glorptype
1048 1251 1500 Glorp Glorptype
1049 >My favorite DNA sequence
1051 1751 2000 Glorp Glorptype
1054 .. _motif_file_format:
1061 <motif> <red> <green> <blue>
1069 IUPAC Nucleotide Code
1070 ~~~~~~~~~~~~~~~~~~~~~~
1072 For your convenience, below is a table of the IUPAC Nucleotide Code.
1074 The following table is table 1 from "Nomenclature for Incompletely
1075 Specified Bases in Nucleic Acid Sequences" which can be found at
1076 http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.
1078 ====== ================= ===================================
1079 Symbol Meaning Origin of designation
1080 ====== ================= ===================================
1089 S G or C Strong interaction (3 H bonds)
1090 W A or T Weak interaction (2 H bonds)
1091 H A or C or T not-G, H follows G in the alphabet
1092 B G or T or C not-A, B follows A
1093 V G or C or A not-T (not-U), V follows U
1094 D G or A or T not-C, D follows C
1095 N G or A or T or C aNy
1096 ====== ================= ===================================
1099 .. Define links below
1102 .. _GPL: http://www.opensource.org/licenses/gpl-license.php
1103 .. _wiki: http://mussa.caltech.edu
1104 .. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
1105 .. _fasta: http://en.wikipedia.org/wiki/FASTA_format
1106 .. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif