8 Last updated: July 7th, 2006
10 Updated to Mussagl build: 200 (Update to 286 in progress)
22 Mussa is an N-way version of the FamilyRelations (which is a part of
23 the Cartwheel project) 2-way comparative sequence analysis
24 software. Given DNA sequence from N species, Mussa uses all possible
25 pairwise comparions to derive an N-wise comparison. For example, given
26 sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
27 1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
28 these comparisons, saving those that satisfy a transitivity
29 requirement. The saved paths are then displayed in an interactive
32 Short History of Mussa
33 ----------------------
36 Mussa Python/PMW Prototype
37 ~~~~~~~~~~~~~~~~~~~~~~~~~~
39 First Python/PMW based protoype.
44 A rewrite for speed purposes using C++ and FLTK GUI toolkit.
49 Refactored version using the more elegant Qt GUI framework and
50 OpenGL for hardware acceleration for those who have beter graphics
59 Mussagl has been released open source under the `GPL v2
67 You have the option of building from source or downloading prebuilt
68 binaries. Most people will want the prebuilt versions.
72 * Mac OS X (binary or source)
73 * Windows XP (binary or source)
79 Mussagl in binary form for OS X and Windows and/or source can be
80 downloaded from http://mussa.caltech.edu/.
87 Once you have downloaded the .dmg file, double click on it and follow
88 the install instructions.
90 FIXME: Mention how to launch the program.
95 Once you have downloaded the Mussagl installer, double click on the
96 installer and follow the install instructions.
98 To start Mussagl, launch the program from Start > Programs > Mussagl >
104 Currently we do not have a binary installer for Linux. You will have
105 to build from source. See the 'build from source' section below.
111 Instructions for building from source can be found `build page
112 <http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild>`_ on the
121 If you already have your data, you can skip ahead to the the `Using
124 Lets say you have a gene of interest called 'SMN1' and you want to
125 know how the sequence surrounding the gene in multiple species is
126 conserved. Guess what, that's what we are going to do, retrieve the
127 DNA sequence for SMN1 and prepare it for using in Mussa.
129 For more information about SMN1 visit `NCBI's OMIM
130 <http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
132 UCSC Genome Browser Method
133 --------------------------
135 There are many methods of retrieving DNA sequence, but for this
136 example we will retrieve SMN1 through the UCSC genome broswer located
137 at http://genome.ucsc.edu/.
139 .. image:: images/ucsc_genome_browser_home.png
140 :alt: UCSC Genome Broswer
146 The first step in finding SMN1 is to use the **Gene Sorter** menu
147 option which I have highlighted in orange below:
149 .. image:: images/ucsc_menu_bar_gene_sorter.png
150 :alt: Gene Sorter Menu Option
155 .. image:: images/ucsc_gene_sorter.png
159 We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
161 .. image:: images/ucsc_gs_sort_name_sim.png
162 :alt: Gene Sorter - Name Similarity
165 After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
167 .. image:: images/ucsc_gs_smn1.png
171 Press **Go!** and you should see the following page:
173 .. image:: images/ucsc_gs_found.png
177 Click on **SMN1** and you will be taking the gene expression atlas
180 .. image:: images/ucsc_gs_genome_position.png
181 :alt: Gene expression atlas
184 Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
187 Now we have found the location of SMN1 on human!
189 .. image:: images/ucsc_gb_smn1_human.png
190 :alt: Genome Browser - SMN1 (human)
194 Step 2 - Download CDS/UTR sequence for annotations
195 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
197 Since we have found **SMN1**, this would be a convient time to extract
198 the DNA sequence for the CDS and UTRs of the gene to use it as an
199 annotation_ in Mussa.
201 **Click on SMN1** shown **between** the **two orange arrows** shown
204 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
205 :alt: Genome Browser - SMN1 (human) - Orange Arrows
208 You should find yourself at the SMN1 description page.
210 .. image:: images/ucsc_gb_smn1_description_page.png
211 :alt: Genome Browser - SMN1 (human) - Description page
214 **Scroll down** until you get to the **Sequence section** and click on
215 **Genomic (chr5:70,256,524-70,284,592)**.
217 .. image:: images/ucsc_gb_smn1_human_sequence.png
218 :alt: Genome Browser - SMN1 (human) - Sequence
221 You should now be at the **Genomic sequence near gene** page:
223 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
224 :alt: Genome Browser - SMN1 (human) - Get genomic sequence
227 Make the following changes (highlighted in orange in the screenshot
230 1. UNcheck **introns**.
231 (We only want to annotate CDS and UTRs.)
232 2. Select **one fasta record** per **region**.
233 (Mussa needs each CDS and UTR represented by one fasta record per CDS/UTR).
234 3. Select **CDS in upper case, UTR in lower case.**
236 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
237 :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
240 Now click the **submit** button. You will then see a fasta file with
241 many fasta records representing the CDS and UTRS.
243 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
244 :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
247 Now you need to save the fasta records to a **text file**. If you are
248 using **Firefox** or **Internet Explorer 6+** click on the **File >
249 Save As** menu option.
251 **IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
252 repeat **NOT Webpage Complete** (see screenshot below.)
254 Type in **smn1_human_annot.txt** for the file name.
256 .. image:: images/smn1_human_annot.png
257 :alt: Genome Browser - SMN1 (human) - sequence annotation file
260 **IMPORTANT:** You should open the file with a text editor and make
261 sure **no html** was saved... If you find any html markup, delete
262 the markup and save the file.
264 Now we are going to **modify the file** you just saved to **add the
265 name of the species** to the **annotation file**. All you have to do
266 is **add a new line** at the **top of the file** with the word **'Human'** as
269 .. image:: images/smn1_human_annot_plus_human.png
270 :alt: Genome Browser - SMN1 (human) - sequence annotation file
273 You can add more annotations to this file if you wish. See the
274 `annotation file format`_ section for details of the file format. By
275 including fasta records in the annotation_ file, Mussa searches your
276 DNA sequence for an exact match of the sequence in the annotation_
277 file. If found, it will be marked as an annotation_ within Mussa.
280 Step 3 - Download gene and upstream/downstream sequence
281 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
283 Use the back button in your web browser to get back the **genome
284 browser view** of **SMN1** as shown below.
286 .. image:: images/ucsc_gb_smn1_human.png
287 :alt: Genome Browser - SMN1 (human)
290 There are two options for getting additional sequence around your
291 gene. The more complex way is to zoom out so that you have the
292 sequence you want being shown in the genome browser and then follow
293 the directions for the following method.
295 The second option, which we will choose, is to leave the genome
296 browser zoomed exactly at the location of SMN1 and click on the
297 **DNA** option on the menu bar (shown with orange arrows in the
300 .. image:: images/ucsc_gb_smn1_human_dna_option.png
301 :alt: Genome Browser - SMN1 (human) - DNA Option
304 Now in the **get dna in window** page, lets add an arbitrary amount of
305 extra sequence on to each end of the gene, lets say 5000 base pairs.
307 .. image:: images/ucsc_gb_smn1_human_get_dna.png
308 :alt: Genome Browser - SMN1 (human) - Get DNA
311 Click the **get DNA** button.
313 .. image:: images/ucsc_gb_smn1_human_dna.png
314 :alt: Genome Browser - SMN1 (human) - DNA
317 Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
318 did in step 2 with the annotation file.
320 **IMPORTANT:** Make sure the file is saved as a text file and not an
321 HTML file. Open the file with a text editor and remove any HTML markup
325 Step 4 - Same/similar/related gene other species.
326 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
328 What good is a multiple sequence alignment viewer without multiple
329 sequences? Lets find a similar gene in a few more species.
331 Use the back button on your web browser until you get the **genome
332 broswer view** of **SMN1** as shown below.
334 .. image:: images/ucsc_genome_browser_home.png
335 :alt: UCSC Genome Broswer
338 **Click on SMN1** shown **between** the **two orange arrows** shown
341 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
342 :alt: Genome Browser - SMN1 (human) - Orange Arrows
345 You should find yourself at the SMN1 description page.
347 .. image:: images/ucsc_gb_smn1_description_page.png
348 :alt: Genome Browser - SMN1 (human) - Description page
351 **Scroll down** until you get to the **Sequence section** and click on
352 **Protein (262 aa)**.
354 .. image:: images/ucsc_gb_smn1_human_sequence.png
355 :alt: Genome Browser - SMN1 (human) - Sequence
358 Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
359 > Copy** option from the menu.
361 .. image:: images/smn1_human_protein.png
362 :alt: Genome Browser - SMN1 (human) - Protein
365 Press the back button on the web browser once and then scroll to the
366 top of the page and click on the **BLAT** option on the menu bar
367 (shown below with orange arrows).
369 .. image:: images/ucsc_gb_smn1_human_blat.png
370 :alt: Genome Browser - SMN1 (human) - Blat
373 **Paste** in the **protein sequence** and **change** the **genome** to
374 **mouse** as shown below and then click **submit**.
376 .. image:: images/ucsc_gb_smn1_human_blat_paste.png
377 :alt: Genome Browser - SMN1 (human) - Blat paste protein
380 Notice that we have two hits, one of which looks pretty good at 89.9%
383 .. image:: images/ucsc_gb_smn1_human_blat_hits.png
384 :alt: Genome Browser - SMN1 (human) - Blat hits
387 **Click** on the **brower** link next to the 89.9% match. Notice in
388 the genome browser (shown below) that there is an annotated gene
389 called SMN1 for mouse which matches the line called **your sequence
390 from blat search**. This means we are fairly confidant we found the
391 right location in the mouse genome.
393 .. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
394 :alt: Genome Browser - SMN1 (human) - Blat to browser
397 Follow steps 1 through 3 for mouse and then repeat step 4 with the
398 human protein sequence to find **SMN1** in the following species (if
409 Make sure to save the extended DNA sequence and annotation file for
418 Launch Mussagl... It should look similar to the screen shot below.
420 .. image:: images/opened.png
427 ----------------------
429 Currently there are three ways to load a Mussa experiment.
431 1. `Create a new analysis`_
432 2. `Load a mussa parameter file`_ (.mupa)
433 3. `Load an analysis`_
437 Create a new analysis
438 ~~~~~~~~~~~~~~~~~~~~~
440 To create a new analysis select 'Define analysis' from the 'File'
441 menu. You should see a dialog box similar to the one below. For this
442 demo we will use the example sequences that come with Mussagl.
444 .. image:: images/define_analysis.png
445 :alt: Define Analysis
450 1. **Give the experiment a name**, for this demo, we'll use
451 'demo_w30_t20'. Mussa will create a folder with this name to store
452 the analysis files in once it has been run.
454 2. Choose a `window size`_. For this demo **choose 30**.
456 3. Choose a threshold_... for this demo **choose 20**. See the
457 Threshold_ section for more detailed information.
459 4. Choose the number of sequences_ you would like. For this demo
462 .. image:: images/define_analysis_step1a.png
466 Now click on the 'Browse' button next to the sequence input box and
467 then select /examples/seq/human_mck_pro.fa file. Do the same in the
468 next two sequence input boxes selecting mouse_mck_pro.fa and
469 rabbit_mck_pro.fa as shown below. Note that you can create annotation
470 files using the mussa `Annotation File Format`_ to add annotations to
473 .. image:: images/define_analysis_step2.png
474 :alt: Choose sequences
477 Click the **create** button and in a few moments you should see
478 something similar to the following screen shot.
480 .. image:: images/demo.png
484 This analysis is now saved in a directory called **demo_w30_t20** in
485 the current working directory. If you close and reopen Mussagl, you
486 can reload the saved analysis. See `Load an analysis`_ section below
490 Load a mussa parameter file
491 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~
493 If you prefer, you can define your Mussa analysis using the Mussa
494 parameter file. See the `Parameter File Format`_ section for details
495 on creating a .mupa file.
497 Once you have a .mupa file created, load Mussagl and select the **File >
498 Load Mussa Parameters** menu option. Select the .mupa file and click
501 .. image:: images/load_mupa_menu.png
502 :alt: Load Mussa Parameters
505 If you would like to see an example, you can load the
506 **mck3test.mupa** file in the examples directory that comes with
509 .. image:: images/load_mupa_dialog.png
510 :alt: Load Mussa Parameters Dialog
517 To load a previously run analysis open Mussagl and select the **File >
518 Load Analysis** menu option. Select an analysis **directory** and
521 .. image:: images/load_analysis_menu.png
522 :alt: Load Analysis Menu
531 .. Screen-shot with numbers showing features.
533 .. image:: images/window_overview.png
539 1. `DNA Sequence (Black bars)`_
545 4. `Conservation tracks`_
549 6. `Zoom Factor`_ (Base pairs per pixel)
551 7. `Dynamic Threshold`_
553 8. `Sequence Information Bar`_
555 9. `Sequence Scroll Bar`_
558 DNA Sequence (black bars)
559 ~~~~~~~~~~~~~~~~~~~~~~~~~
561 .. image:: images/sequence_bar.png
565 Each of the black bars represents one of the loaded sequences, in this
566 case the sequence around the gene 'MCK' in human, mouse, and rabbit.
568 FIXME: Should I mention the repeats here?
574 .. figure:: images/annotation.png
578 Annotation shown in green on sequence bar.
581 Annotations can be included on any of the sequences using the `Load a
582 mussa parameter file`_ method of loading your sequences. You can
583 define annotations by location or using an exact sub-sequence and you
584 may also choose any color for display of the annotation; see the
585 `Annotation File Format`_ section for details.
587 Note: Currently there is no way to add annotations using the GUI (only
588 via the .mupa file). We plan to add this feature in the future, but it
589 likely will not make it into the first release.
595 .. figure:: images/motif.png
599 Motif shown in light blue on sequence bar.
601 The only real difference between an annotation and motif in Mussagl is
602 that you can define motifs from within the GUI. See the `Motifs`_
603 section for more information.
609 .. figure:: images/conservation_tracks.png
610 :alt: Conservation Tracks
613 Conservations tracks shown as red and blue lines between sequence
616 The **red lines** between the sequence bars represent conservation
617 between the sequences and **blue lines** represent **reverse
618 complement** conservation. The amount of sequence conservation shown
619 will depend on the relatedness of your sequences and the `dynamic
620 threshold` you are using. Sequences with lots of repeats will cause
621 major slow downs in calculating the matches.
627 .. image:: images/motif_toggle.png
631 Toggles motifs on and off. This will not turn on and off annotations.
633 Note: As of the current build (#200), this feature hasn't been
640 .. image:: images/zoom_factor.png
644 The zoom factor represents the number of base pairs represented per
645 pixel. When you zoom in far enough the sequence will switch from
646 seeing a black bar, representing the sequence, to the actual sequence
647 (well, ASCII representation of sequence).
653 .. image:: images/dynamic_threshold.png
654 :alt: Dynamic Threshold
657 You can dynamically change the threshold for how strong of match you
658 consider the conservation to be with one of two options:
660 1. Number of base pair matches out of window size.
662 2. Percent base pair conservation.
664 See the Threshold_ section for more information.
667 Sequence Information Bar
668 ~~~~~~~~~~~~~~~~~~~~~~~~
670 .. image:: images/seq_info_bar.png
671 :alt: Sequence Information Bar
674 The sequence information bars can be found to the left and right sides
675 of Mussagl. Next to each sequence you will find the following
678 1. Species (If it has been defined)
679 2. Total Size of Sequence
680 3. Current base pair position
686 .. image:: images/scroll_bar.png
687 :alt: Sequence Scroll Bar
690 The scroll bar allows you to scroll through the sequence which is
691 useful when you have zoomed in using the `zoom factor`_.
700 Currently annotations can be added to a sequence using the mussa
701 `annotation file format`_ and can be loaded by selecting the
702 annotation file when defining a new analysis (see `Create a new
703 analysis`_ section) or by defining a .mupa file pointing to your
704 annotation file (see `Load a mussa parameter file`_ section).
709 Load Motifs from File
710 *********************
712 It is possible to load motifs from a file which was saved from a
713 previous run or by defining your own motif file. See the `Motif File
714 Format`_ section for details.
716 To load a motif file, select **Load Motif List** item from the
717 **File** menu and select a motif list file.
719 .. image:: images/load_motif.png
720 :alt: Load Motif List
727 Note: Currently not implemented
733 Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
734 Code`_ for defining a motif. To define a motif, select **View > Edit
735 Motifs** menu item as shown below.
737 .. image:: images/view_edit_motifs.png
738 :alt: "View > Edit Motifs" Menu
741 You will see a dialog box appear with a "set motifs" button and 10
742 rows for defining motifs and the color that will be displayed on the
743 sequence. By default all 10 motifs start off as with white as the
744 color. In the image below, I changed the color from white to blue to
745 make it easier to see.
747 .. image:: images/motif_dialog_start.png
751 Now lets make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
752 Code`_, type in **'ATSCT'** into the first box as shown below.
754 .. image:: images/motif_dialog_enter_motif.png
758 Now choose a color for your motif by clicking on the colored area to
759 the left of the motif. In the image above, you would click on the blue
760 square, but by default the squares will be white. Remember to choose a
761 color that will show up well with a black bar as the background.
763 .. image:: images/color_chooser.png
767 Once you have selected the color for your motif, click on the 'set
768 motifs' button. Notice that if Mussa finds matches to your motif will
769 now show up in the main Mussagl window.
773 .. image:: images/motif_dialog_bar_before.png
774 :alt: Sequence bar before motif
779 .. image:: images/motif_dialog_bar_after.png
780 :alt: Sequence bar after motif
784 View Mussa Alignements
785 ----------------------
787 Mussagl allows you to zoom in on Mussa alignments by selecting the set
788 of alignment(s) of interest. To do this, move the mouse near the
789 alignment you are interested in viewing and then **PRESS** and
790 **HOLD** the **LEFT mouse button** and **drag the mouse** to the other
791 side of the conservation track so that you see a bounding box
792 overlaping the alienment(s) of interest and then **let go** of the
795 In the example below, I started by left clicking on the area marked by
796 a red dot (upper left corner of bounding box) and draging the mouse to
797 the area marked by a blue dot (lower right corner of the bounding box)
798 and letting go of the left mouse button.
800 .. image:: images/select_sequence.png
801 :alt: Select Sequence
804 All of the lines which were not selected should be washed out as shown
807 .. image:: images/washed_out.png
808 :alt: Tracks washed out
811 With a selection made, goto the **View** menu and select **View mussa alignment**.
813 .. image:: images/view_mussa_alignment.png
814 :alt: View mussa alignment
817 You should see the alignment at the base-pair level as shown below.
819 .. image:: images/mussa_alignment.png
820 :alt: Mussa alignment
827 To run a sub-analysis **highlight** a section of sequence and *right
828 click* on it and select **Add to subanalysis**. To the same for the
829 sequences shown in orange in the screenshot below. Note that you **are
830 NOT limited** to selecting more than one subsequence from the same
833 .. image:: images/subanalysis_select_seqs.png
834 :alt: Subanalysis sequence selection
837 Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
839 .. image:: images/subanalysis_dialog.png
840 :alt: Subanalysis Dialog
843 A new Mussa window will appear with the subanalysis of your sequences
844 once it's done running. This may take a while if you selected large
845 chunks of sequence with a loose threshold.
847 .. image:: images/subanalysis_done.png
848 :alt: Subalaysis complete
852 Copying sequence to clipboard
853 -----------------------------
855 To copy a sequence to the clipboard, highlight a section of sequence,
856 as shown in the screen shot below, and do one of the following:
858 * Select **Copy as Fasta** from the **Edit** menu.
859 * **Right Click (Left click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as Fasta**.
860 * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
862 .. image:: images/copy_sequence.png
867 ---------------------------------
869 FIXME: Need to write this section
878 The threshold of an analysis is in minimum number of base pair matches
879 must be meet to in order to be kept as a match. Note that you can vary
880 the threshold from within Mussagl. For example, if you choose a
881 `window size`_ of **30** and a **threshold** of **20** the mussa nway
882 transitive algorithm will store all matches that are 20 out of 30 bp
883 matches or better and pass it on to Mussagl. Mussagl will then allow
884 you to dynamically choose a threshold from 20 to 30 base pairs. A
885 threshold of 30 bps would only show 30 out of 30 bp matches. A
886 threshold of 20 bps would show all matches of 20 out of 30 bps or
887 better. If you would like to see results for matches lower than 20 out
888 of 30, you will need to rerun the analysis with a lower threshold.
893 The typical sizes people tend to choose are between 20 and 30. You
894 will likely need to experiment with this setting depending on your
895 needs and input sequence.
901 Mussa reads in sequences which are formatted in the fasta_
902 format. Mussa may take a long time to run (>10 minutes) if the total
903 bp length near 280Kb. Once mussa has run once, you can reload
904 previously run analyzes.
906 FIXME: We have learned more about how much sequence and how many to
907 put in Mussagl, this information should be documented here.
915 Parameter File Format
916 ~~~~~~~~~~~~~~~~~~~~~
918 **File Format (.mupa):**
922 # name of analysis directory and stem for associated files
923 ANA_NAME <analysis_name>
925 # if APPEND vars true, a _wXX and/or _tYY added to analysis name
926 # where XX = WINDOW and YY = THRESHOLD
927 # Highly recommeded with use of command line override of WINDOW or THRESHOLD
928 APPEND_WIN <true/false>
929 APPEND_THRES <true/false>
931 # how many sequences are being analyzed
934 # first sequence info
935 SEQUENCE <fasta_file_path>
936 ANNOTATION <annotation_file_path>
937 SEQ_START <sequence_start>
939 # the second sequence info
940 SEQUENCE <fasta_file_path>
941 # ANNOTATION <annotation_file_path>
942 SEQ_START <sequence_start>
943 # SEQ_END <sequence_end>
945 # third sequence info
946 SEQUENCE <fasta_file_path>
947 # ANNOTATION <annotation_file_path>
949 # analyzes parameters: command line args -w -t will override these
953 .. csv-table:: Parameter File Options:
954 :header: "Option Name", "Value", "Default", "Required", "Description"
955 :widths: 30 30 30 30 60
957 "ANA_NAME", "string", "N/A", "true", "Name of analysis (Also
958 name of directory where analysis will be saved."
959 "APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
960 "APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
961 "SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
963 "SEQUENCE", "/fasta/filepath.fa", "N/A", "true", "Must define one
964 sequence per SEQUENCE_NUM."
965 "ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
966 annotation file. See `annotation file format`_ section for more
968 "SEQ_START", "integer", "1", "false", "Optional index into fasta file"
969 "SEQ_END", "integer", "1", "false", "Optional index into fasta file"
970 "WINDOW", "integer", "N/A", "true", "`Window Size`_"
971 "THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
975 Annotation File Format
976 ~~~~~~~~~~~~~~~~~~~~~~
978 The first line in the file is the sequence name. Each line there after
979 is a **space** separated annotation.
983 * The annotation format now supports fasta sequences embedded in the
984 annotation file as shown in the format example below. Mussagl will
985 take this sequence and look for an exact match of this sequence in
986 your sequences. If a match is found, it will label it with the name
987 of from the fasta header.
993 <species/sequence_name>
994 <start> <stop> <annotation_name> <annotation_type>
995 <start> <stop> <annotation_name> <annotation_type>
996 <start> <stop> <annotation_name> <annotation_type>
997 <start> <stop> <annotation_name> <annotation_type>
999 ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
1000 ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
1001 TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
1002 ACGTACGGCAGTACGCGGTCAGA
1003 <start> <stop> <annotation_name> <annotation_type>
1011 251 500 Glorp Glorptype
1012 751 1000 Glorp Glorptype
1013 1251 1500 Glorp Glorptype
1014 >My favorite DNA sequence
1016 1751 2000 Glorp Glorptype
1019 .. _motif_file_format:
1026 <motif> <red> <green> <blue>
1034 IUPAC Nucleotide Code
1035 ~~~~~~~~~~~~~~~~~~~~~~
1037 For your convenience, below is a table of the IUPAC Nucleotide Code.
1039 The following table is table 1 from "Nomenclature for Incompletely
1040 Specified Bases in Nucleic Acid Sequences" which can be found at
1041 http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.
1043 ====== ================= ===================================
1044 Symbol Meaning Origin of designation
1045 ====== ================= ===================================
1054 S G or C Strong interaction (3 H bonds)
1055 W A or T Weak interaction (2 H bonds)
1056 H A or C or T not-G, H follows G in the alphabet
1057 B G or T or C not-A, B follows A
1058 V G or C or A not-T (not-U), V follows U
1059 D G or A or T not-C, D follows C
1060 N G or A or T or C aNy
1061 ====== ================= ===================================
1064 .. Define links below
1067 .. _GPL: http://www.opensource.org/licenses/gpl-license.php
1068 .. _wiki: http://mussa.caltech.edu
1069 .. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
1070 .. _fasta: http://en.wikipedia.org/wiki/FASTA_format
1071 .. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif