8 Last updated: Sept 20th, 2006
10 Updated to Mussagl build: 287 (In process to 381)
14 * New features / change log
15 * Comment out anything isn't implemented yet.
16 * (DONE) List of features that will be implemented in the future.
17 * Look into the homology mapping of UCSC.
18 * Add toggle to genomes.
19 * Document why one fast record per region.
20 * How to deal with the hazards of small utrs vis motif finder. (Add warning)
21 * Add warning about saving FASTA file.
22 * Add a general principles section near the top
23 * Using comparison algorithm which will pickup all repeats
24 * Add info about repeatmasking
25 * Checking upstream and downstream genes for make sure you are in the right regions.
26 * Later on: look into Ensembl
27 * Look into method of homology instead of blating.
28 * Mention advantages of using mupa.
29 * Mention the difference between using arrows and scroll bar
30 * Document the color for motifs
31 * Update for Mac user left-click
33 * Wormbase/Flybase/mirBASE tutorials
46 * Analysis "Save As" feature
51 .. INSERT CHANGE LOG HERE
52 .. END INSERT CHANGE LOG
54 Features to be Implemented
55 --------------------------
57 * Motif editor supporting more than 10 motifs
58 (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/122)
59 * Save motifs from Mussagl
60 (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/133)
62 For an up-to-date list of features to be implemented visit:
63 http://woldlab.caltech.edu/cgi-bin/mussa/roadmap
72 Mussa is an N-way version of the FamilyRelations (which is a part of
73 the Cartwheel project) 2-way comparative sequence analysis
74 software. Given DNA sequence from N species, Mussa uses all possible
75 pairwise comparions to derive an N-wise comparison. For example, given
76 sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
77 1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
78 these comparisons, saving those that satisfy a transitivity
79 requirement. The saved paths are then displayed in an interactive
82 Short History of Mussa
83 ----------------------
85 Mussa Python/PMW Prototype
86 ~~~~~~~~~~~~~~~~~~~~~~~~~~
88 First Python/PMW based protoype.
93 A rewrite for speed purposes using C++ and FLTK GUI toolkit.
98 Refactored version using the more elegant Qt GUI framework and
99 OpenGL for hardware acceleration for those who have better graphics
108 Mussagl has been released open source under the `GPL v2
116 You have the option of building from source or downloading prebuilt
117 binaries. Most people will want the prebuilt versions.
121 * Mac OS X (binary or source)
122 * Windows XP (binary or source)
128 Mussagl in binary form for OS X and Windows and/or source can be
129 downloaded from http://mussa.caltech.edu/.
136 Once you have downloaded the .dmg file, double click on it and follow
137 the install instructions.
139 FIXME: Mention how to launch the program.
144 Once you have downloaded the Mussagl installer, double click on the
145 installer and follow the install instructions.
147 To start Mussagl, launch the program from Start > Programs > Mussagl >
153 Currently we do not have a binary installer for Linux. You will have
154 to build from source. See the 'build from source' section below.
160 Instructions for building from source can be found `build page
161 <http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild>`_ on the
170 If you already have your data, you can skip ahead to the the `Using
173 Let's say you have a gene of interest called 'SMN1' and you want to
174 know how the sequence surrounding the gene in multiple species is
175 conserved. Guess what, that's what we are going to do, retrieve the
176 DNA sequence for SMN1 and prepare it for using in Mussa.
178 For more information about SMN1 visit `NCBI's OMIM
179 <http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
181 UCSC Genome Browser Method
182 --------------------------
184 There are many methods of retrieving DNA sequence, but for this
185 example we will retrieve SMN1 through the UCSC genome browser located
186 at http://genome.ucsc.edu/.
188 .. image:: images/ucsc_genome_browser_home.png
189 :alt: UCSC Genome Browser
195 The first step in finding SMN1 is to use the **Gene Sorter** menu
196 option which I have highlighted in orange below:
198 .. image:: images/ucsc_menu_bar_gene_sorter.png
199 :alt: Gene Sorter Menu Option
204 .. image:: images/ucsc_gene_sorter.png
208 We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
210 .. image:: images/ucsc_gs_sort_name_sim.png
211 :alt: Gene Sorter - Name Similarity
214 After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
216 .. image:: images/ucsc_gs_smn1.png
220 Press **Go!** and you should see the following page:
222 .. image:: images/ucsc_gs_found.png
226 Click on **SMN1** and you will be taking the gene expression atlas
229 .. image:: images/ucsc_gs_genome_position.png
230 :alt: Gene expression atlas
233 Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
236 Now we have found the location of SMN1 on human!
238 .. image:: images/ucsc_gb_smn1_human.png
239 :alt: Genome Browser - SMN1 (human)
243 Step 2 - Download CDS/UTR sequence for annotations
244 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
246 Since we have found **SMN1**, this would be a convenient time to extract
247 the DNA sequence for the CDS and UTRs of the gene to use it as an
248 annotation_ in Mussa.
250 **Click on SMN1** shown **between** the **two orange arrows** shown
253 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
254 :alt: Genome Browser - SMN1 (human) - Orange Arrows
257 You should find yourself at the SMN1 description page.
259 .. image:: images/ucsc_gb_smn1_description_page.png
260 :alt: Genome Browser - SMN1 (human) - Description page
263 **Scroll down** until you get to the **Sequence section** and click on
264 **Genomic (chr5:70,256,524-70,284,592)**.
266 .. image:: images/ucsc_gb_smn1_human_sequence.png
267 :alt: Genome Browser - SMN1 (human) - Sequence
270 You should now be at the **Genomic sequence near gene** page:
272 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
273 :alt: Genome Browser - SMN1 (human) - Get genomic sequence
276 Make the following changes (highlighted in orange in the screenshot
279 1. UNcheck **introns**.
280 (We only want to annotate CDS and UTRs.)
281 2. Select **one FASTA record** per **region**.
282 (Mussa needs each CDS and UTR represented by one FASTA record per CDS/UTR).
283 3. Select **CDS in upper case, UTR in lower case.**
285 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
286 :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
289 Now click the **submit** button. You will then see a FASTA file with
290 many FASTA records representing the CDS and UTRS.
292 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
293 :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
296 Now you need to save the FASTA records to a **text file**. If you are
297 using **Firefox** or **Internet Explorer 6+** click on the **File >
298 Save As** menu option.
300 **IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
301 repeat **NOT Webpage Complete** (see screenshot below.)
303 Type in **smn1_human_annot.txt** for the file name.
305 .. image:: images/smn1_human_annot.png
306 :alt: Genome Browser - SMN1 (human) - sequence annotation file
309 **IMPORTANT:** You should open the file with a text editor and make
310 sure **no HTML** was saved... If you find any HTML markup, delete
311 the markup and save the file.
313 Now we are going to **modify the file** you just saved to **add the
314 name of the species** to the **annotation file**. All you have to do
315 is **add a new line** at the **top of the file** with the word **'Human'** as
318 .. image:: images/smn1_human_annot_plus_human.png
319 :alt: Genome Browser - SMN1 (human) - sequence annotation file
322 You can add more annotations to this file if you wish. See the
323 `annotation file format`_ section for details of the file format. By
324 including FASTA records in the annotation_ file, Mussa searches your
325 DNA sequence for an exact match of the sequence in the annotation_
326 file. If found, it will be marked as an annotation_ within Mussa.
329 Step 3 - Download gene and upstream/downstream sequence
330 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
332 Use the back button in your web browser to get back the **genome
333 browser view** of **SMN1** as shown below.
335 .. image:: images/ucsc_gb_smn1_human.png
336 :alt: Genome Browser - SMN1 (human)
339 There are two options for getting additional sequence around your
340 gene. The more complex way is to zoom out so that you have the
341 sequence you want being shown in the genome browser and then follow
342 the directions for the following method.
344 The second option, which we will choose, is to leave the genome
345 browser zoomed exactly at the location of SMN1 and click on the
346 **DNA** option on the menu bar (shown with orange arrows in the
349 .. image:: images/ucsc_gb_smn1_human_dna_option.png
350 :alt: Genome Browser - SMN1 (human) - DNA Option
353 Now in the **get dna in window** page, let's add an arbitrary amount of
354 extra sequence on to each end of the gene, let's say 5000 base pairs.
356 .. image:: images/ucsc_gb_smn1_human_get_dna.png
357 :alt: Genome Browser - SMN1 (human) - Get DNA
360 Click the **get DNA** button.
362 .. image:: images/ucsc_gb_smn1_human_dna.png
363 :alt: Genome Browser - SMN1 (human) - DNA
366 Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
367 did in step 2 with the annotation file.
369 **IMPORTANT:** Make sure the file is saved as a text file and not an
370 HTML file. Open the file with a text editor and remove any HTML markup
374 Step 4 - Same/similar/related gene other species.
375 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
377 What good is a multiple sequence alignment viewer without multiple
378 sequences? Let'S find a similar gene in a few more species.
380 Use the back button on your web browser until you get the **genome
381 browser view** of **SMN1** as shown below.
383 .. image:: images/ucsc_genome_browser_home.png
384 :alt: UCSC Genome Browser
387 **Click on SMN1** shown **between** the **two orange arrows** shown
390 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
391 :alt: Genome Browser - SMN1 (human) - Orange Arrows
394 You should find yourself at the SMN1 description page.
396 .. image:: images/ucsc_gb_smn1_description_page.png
397 :alt: Genome Browser - SMN1 (human) - Description page
400 **Scroll down** until you get to the **Sequence section** and click on
401 **Protein (262 aa)**.
403 .. image:: images/ucsc_gb_smn1_human_sequence.png
404 :alt: Genome Browser - SMN1 (human) - Sequence
407 Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
408 > Copy** option from the menu.
410 .. image:: images/smn1_human_protein.png
411 :alt: Genome Browser - SMN1 (human) - Protein
414 Press the back button on the web browser once and then scroll to the
415 top of the page and click on the **BLAT** option on the menu bar
416 (shown below with orange arrows).
418 .. image:: images/ucsc_gb_smn1_human_blat.png
419 :alt: Genome Browser - SMN1 (human) - Blat
422 **Paste** in the **protein sequence** and **change** the **genome** to
423 **mouse** as shown below and then click **submit**.
425 .. image:: images/ucsc_gb_smn1_human_blat_paste.png
426 :alt: Genome Browser - SMN1 (human) - Blat paste protein
429 Notice that we have two hits, one of which looks pretty good at 89.9%
432 .. image:: images/ucsc_gb_smn1_human_blat_hits.png
433 :alt: Genome Browser - SMN1 (human) - Blat hits
436 **Click** on the **brower** link next to the 89.9% match. Notice in
437 the genome browser (shown below) that there is an annotated gene
438 called SMN1 for mouse which matches the line called **your sequence
439 from blat search**. This means we are fairly confidant we found the
440 right location in the mouse genome.
442 .. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
443 :alt: Genome Browser - SMN1 (human) - Blat to browser
446 Follow steps 1 through 3 for mouse and then repeat step 4 with the
447 human protein sequence to find **SMN1** in the following species (if
458 Make sure to save the extended DNA sequence and annotation file for
467 Launch Mussagl... It should look similar to the screen shot below.
469 .. image:: images/opened.png
476 ----------------------
478 Currently there are three ways to load a Mussa experiment.
480 1. `Create a new analysis`_
481 2. `Load a mussa parameter file`_ (.mupa)
482 3. `Load an analysis`_
486 Create a new analysis
487 ~~~~~~~~~~~~~~~~~~~~~
489 To create a new analysis select 'Define analysis' from the 'File'
490 menu. You should see a dialog box similar to the one below. For this
491 demo we will use the example sequences that come with Mussagl.
493 .. image:: images/define_analysis.png
494 :alt: Define Analysis
499 1. **Give the experiment a name**, for this demo, we'll use
500 'demo_w30_t20'. Mussa will create a folder with this name to store
501 the analysis files in once it has been run.
503 2. Choose a `window size`_. For this demo **choose 30**.
505 3. Choose a threshold_... for this demo **choose 20**. See the
506 Threshold_ section for more detailed information.
508 4. Choose the number of sequences_ you would like. For this demo
511 .. image:: images/define_analysis_step1a.png
515 Now click on the 'Browse' button next to the sequence input box and
516 then select /examples/seq/human_mck_pro.fa file. Do the same in the
517 next two sequence input boxes selecting mouse_mck_pro.fa and
518 rabbit_mck_pro.fa as shown below. Note that you can create annotation
519 files using the mussa `Annotation File Format`_ to add annotations to
522 .. image:: images/define_analysis_step2.png
523 :alt: Choose sequences
526 Click the **create** button and in a few moments you should see
527 something similar to the following screen shot.
529 .. image:: images/demo.png
533 This analysis is now saved in a directory called **demo_w30_t20** in
534 the current working directory. If you close and reopen Mussagl, you
535 can reload the saved analysis. See `Load an analysis`_ section below
539 Load a mussa parameter file
540 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~
542 If you prefer, you can define your Mussa analysis using the Mussa
543 parameter file. See the `Parameter File Format`_ section for details
544 on creating a .mupa file.
546 Once you have a .mupa file created, load Mussagl and select the **File >
547 Load Mussa Parameters** menu option. Select the .mupa file and click
550 .. image:: images/load_mupa_menu.png
551 :alt: Load Mussa Parameters
554 If you would like to see an example, you can load the
555 **mck3test.mupa** file in the examples directory that comes with
558 .. image:: images/load_mupa_dialog.png
559 :alt: Load Mussa Parameters Dialog
566 To load a previously run analysis open Mussagl and select the **File >
567 Load Analysis** menu option. Select an analysis **directory** and
570 .. image:: images/load_analysis_menu.png
571 :alt: Load Analysis Menu
580 .. Screen-shot with numbers showing features.
582 .. image:: images/window_overview.png
588 1. `DNA Sequence (Black bars)`_
594 4. `Conservation tracks`_
598 6. `Zoom Factor`_ (Base pairs per pixel)
600 7. `Dynamic Threshold`_
602 8. `Sequence Information Bar`_
604 9. `Sequence Scroll Bar`_
607 DNA Sequence (black bars)
608 ~~~~~~~~~~~~~~~~~~~~~~~~~
610 .. image:: images/sequence_bar.png
614 Each of the black bars represents one of the loaded sequences, in this
615 case the sequence around the gene 'MCK' in human, mouse, and rabbit.
617 FIXME: Should I mention the repeats here?
623 .. figure:: images/annotation.png
627 Annotation shown in green on sequence bar.
630 Annotations can be included on any of the sequences using the `Load a
631 mussa parameter file`_ method of loading your sequences. You can
632 define annotations by location or using an exact sub-sequence and you
633 may also choose any color for display of the annotation; see the
634 `Annotation File Format`_ section for details.
636 Note: Currently there is no way to add annotations using the GUI (only
637 via the .mupa file). We plan to add this feature in the future, but it
638 likely will not make it into the first release.
644 .. figure:: images/motif.png
648 Motif shown in light blue on sequence bar.
650 The only real difference between an annotation and motif in Mussagl is
651 that you can define motifs from within the GUI. See the `Motifs`_
652 section for more information.
658 .. figure:: images/conservation_tracks.png
659 :alt: Conservation Tracks
662 Conservations tracks shown as red and blue lines between sequence
665 The **red lines** between the sequence bars represent conservation
666 between the sequences and **blue lines** represent **reverse
667 complement** conservation. The amount of sequence conservation shown
668 will depend on the relatedness of your sequences and the `dynamic
669 threshold` you are using. Sequences with lots of repeats will cause
670 major slow downs in calculating the matches.
676 .. image:: images/motif_toggle.png
680 Toggles motifs on and off. This will not turn on and off annotations.
682 Note: As of the current build (#200), this feature hasn't been
689 .. image:: images/zoom_factor.png
693 The zoom factor represents the number of base pairs represented per
694 pixel. When you zoom in far enough the sequence will switch from
695 seeing a black bar, representing the sequence, to the actual sequence
696 (well, ASCII representation of sequence).
702 .. image:: images/dynamic_threshold.png
703 :alt: Dynamic Threshold
706 You can dynamically change the threshold for how strong a match you
707 consider the conservation to be with one of two options:
709 1. Number of base pair matches out of window size.
711 2. Percent base pair conservation.
713 See the Threshold_ section for more information.
716 Sequence Information Bar
717 ~~~~~~~~~~~~~~~~~~~~~~~~
719 .. image:: images/seq_info_bar.png
720 :alt: Sequence Information Bar
723 The sequence information bars can be found to the left and right sides
724 of Mussagl. Next to each sequence you will find the following
727 1. Species (If it has been defined)
728 2. Total Size of Sequence
729 3. Current base pair position
735 .. image:: images/scroll_bar.png
736 :alt: Sequence Scroll Bar
739 The scroll bar allows you to scroll through the sequence which is
740 useful when you have zoomed in using the `zoom factor`_.
749 Currently annotations can be added to a sequence using the mussa
750 `annotation file format`_ and can be loaded by selecting the
751 annotation file when defining a new analysis (see `Create a new
752 analysis`_ section) or by defining a .mupa file pointing to your
753 annotation file (see `Load a mussa parameter file`_ section).
758 Load Motifs from File
759 *********************
761 It is possible to load motifs from a file which was saved from a
762 previous run or by defining your own motif file. See the `Motif File
763 Format`_ section for details.
765 To load a motif file, select **Load Motif List** item from the
766 **File** menu and select a motif list file.
768 .. image:: images/load_motif.png
769 :alt: Load Motif List
776 Note: Currently not implemented
785 * Allow for toggling individual motifs on and off.
788 * Field added for naming motifs.
790 Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
791 Code`_ for defining a motif. To define a motif, select **Edit > Edit
792 Motifs** menu item as shown below.
794 .. image:: images/view_edit_motifs.png
795 :alt: "View > Edit Motifs" Menu
798 You will see a dialog box appear with a "set motifs" button and 10
799 rows for defining motifs and the color that will be displayed on the
800 sequence. By default all 10 motifs start off as with white as the
801 color. In the image below, I changed the color from white to blue to
802 make it easier to see. The first text box is for the motif and the
803 second box is for the name of the motif. The check box defines whether
804 the motif is displayed or not.
806 .. image:: images/motif_dialog_start.png
810 Now let's make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
811 Code`_, type in **'ATSCT'** into the first box and 'My Motif' for the
812 name in the second box as shown below.
814 .. image:: images/motif_dialog_enter_motif.png
818 Now choose a color for your motif by clicking on the colored area to
819 the left of the motif. In the image above, you would click on the blue
820 square, but by default the squares will be white. Remember to choose a
821 color that will show up well with a black bar as the background.
823 .. image:: images/color_chooser.png
827 Once you have selected the color for your motif, click on the 'set
828 motifs' button. Notice that if Mussa finds matches to your motif will
829 now show up in the main Mussagl window.
833 .. image:: images/motif_dialog_bar_before.png
834 :alt: Sequence bar before motif
839 .. image:: images/motif_dialog_bar_after.png
840 :alt: Sequence bar after motif
844 View Mussa Alignments
845 ---------------------
847 Mussagl allows you to zoom in on Mussa alignments by selecting the set
848 of alignment(s) of interest. To do this, move the mouse near the
849 alignment you are interested in viewing and then **PRESS** and
850 **HOLD** the **LEFT mouse button** and **drag the mouse** to the other
851 side of the conservation track so that you see a bounding box
852 overlaping the alienment(s) of interest and then **let go** of the
855 In the example below, I started by left-clicking on the area marked by
856 a red dot (upper left corner of bounding box) and dragging the mouse to
857 the area marked by a blue dot (lower right corner of the bounding box)
858 and letting go of the left mouse button.
860 .. image:: images/select_sequence.png
861 :alt: Select Sequence
864 All of the lines which were not selected should be washed out as shown
867 .. image:: images/washed_out.png
868 :alt: Tracks washed out
871 With a selection made, goto the **View** menu and select **View mussa alignment**.
873 .. image:: images/view_mussa_alignment.png
874 :alt: View mussa alignment
877 You should see the alignment at the base-pair level as shown below.
879 .. image:: images/mussa_alignment.png
880 :alt: Mussa alignment
887 To run a sub-analysis **highlight** a section of sequence and *right
888 click* on it and select **Add to subanalysis**. To the same for the
889 sequences shown in orange in the screenshot below. Note that you **are
890 NOT limited** to selecting more than one subsequence from the same
893 .. image:: images/subanalysis_select_seqs.png
894 :alt: Subanalysis sequence selection
897 Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
899 .. image:: images/subanalysis_dialog.png
900 :alt: Subanalysis Dialog
903 A new Mussa window will appear with the subanalysis of your sequences
904 once it's done running. This may take a while if you selected large
905 chunks of sequence with a loose threshold.
907 .. image:: images/subanalysis_done.png
908 :alt: Subalaysis complete
912 Copying sequence to clipboard
913 -----------------------------
915 To copy a sequence to the clipboard, highlight a section of sequence,
916 as shown in the screen shot below, and do one of the following:
918 * Select **Copy as FASTA** from the **Edit** menu.
919 * **Right-Click (Left-click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as FASTA**.
920 * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
922 .. image:: images/copy_sequence.png
927 ---------------------------------
929 FIXME: Need to write this section
938 The threshold of an analysis is in minimum number of base pair matches
939 must be meet to in order to be kept as a match. Note that you can vary
940 the threshold from within Mussagl. For example, if you choose a
941 `window size`_ of **30** and a **threshold** of **20** the mussa nway
942 transitive algorithm will store all matches that are 20 out of 30 bp
943 matches or better and pass it on to Mussagl. Mussagl will then allow
944 you to dynamically choose a threshold from 20 to 30 base pairs. A
945 threshold of 30 bps would only show 30 out of 30 bp matches. A
946 threshold of 20 bps would show all matches of 20 out of 30 bps or
947 better. If you would like to see results for matches lower than 20 out
948 of 30, you will need to rerun the analysis with a lower threshold.
953 The typical sizes people tend to choose are between 20 and 30. You
954 will likely need to experiment with this setting depending on your
955 needs and input sequence.
961 Mussa reads in sequences which are formatted in the FASTA_
962 format. Mussa may take a long time to run (>10 minutes) if the total
963 bp length near 280Kb. Once mussa has run once, you can reload
964 previously run analyzes.
966 FIXME: We have learned more about how much sequence and how many to
967 put in Mussagl, this information should be documented here.
975 Parameter File Format
976 ~~~~~~~~~~~~~~~~~~~~~
978 **File Format (.mupa):**
982 # name of analysis directory and stem for associated files
983 ANA_NAME <analysis_name>
985 # if APPEND vars true, a _wXX and/or _tYY added to analysis name
986 # where XX = WINDOW and YY = THRESHOLD
987 # Highly recommeded with use of command line override of WINDOW or THRESHOLD
988 APPEND_WIN <true/false>
989 APPEND_THRES <true/false>
991 # how many sequences are being analyzed
994 # first sequence info
995 SEQUENCE <FASTA_file_path>
996 ANNOTATION <annotation_file_path>
997 SEQ_START <sequence_start>
999 # the second sequence info
1000 SEQUENCE <FASTA_file_path>
1001 # ANNOTATION <annotation_file_path>
1002 SEQ_START <sequence_start>
1003 # SEQ_END <sequence_end>
1005 # third sequence info
1006 SEQUENCE <FASTA_file_path>
1007 # ANNOTATION <annotation_file_path>
1009 # analyzes parameters: command line args -w -t will override these
1013 .. csv-table:: Parameter File Options:
1014 :header: "Option Name", "Value", "Default", "Required", "Description"
1015 :widths: 30 30 30 30 60
1017 "ANA_NAME", "string", "N/A", "true", "Name of analysis (Also
1018 name of directory where analysis will be saved."
1019 "APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
1020 "APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
1021 "SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
1023 "SEQUENCE", "/FASTA/filepath.fa", "N/A", "true", "Must define one
1024 sequence per SEQUENCE_NUM."
1025 "ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
1026 annotation file. See `annotation file format`_ section for more
1028 "SEQ_START", "integer", "1", "false", "Optional index into FASTA file"
1029 "SEQ_END", "integer", "1", "false", "Optional index into FASTA file"
1030 "WINDOW", "integer", "N/A", "true", "`Window Size`_"
1031 "THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
1035 Annotation File Format
1036 ~~~~~~~~~~~~~~~~~~~~~~
1038 The first line in the file is the sequence name. Each line there after
1039 is a **space** separated annotation.
1041 New as of build 198:
1043 * The annotation format now supports FASTA sequences embedded in the
1044 annotation file as shown in the format example below. Mussagl will
1045 take this sequence and look for an exact match of this sequence in
1046 your sequences. If a match is found, it will label it with the name
1047 of from the FASTA header.
1053 <species/sequence_name>
1054 <start> <stop> <annotation_name> <annotation_type>
1055 <start> <stop> <annotation_name> <annotation_type>
1056 <start> <stop> <annotation_name> <annotation_type>
1057 <start> <stop> <annotation_name> <annotation_type>
1059 ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
1060 ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
1061 TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
1062 ACGTACGGCAGTACGCGGTCAGA
1063 <start> <stop> <annotation_name> <annotation_type>
1071 251 500 Glorp Glorptype
1072 751 1000 Glorp Glorptype
1073 1251 1500 Glorp Glorptype
1074 >My favorite DNA sequence
1076 1751 2000 Glorp Glorptype
1079 .. _motif_file_format:
1086 <motif> <red> <green> <blue>
1094 IUPAC Nucleotide Code
1095 ~~~~~~~~~~~~~~~~~~~~~~
1097 For your convenience, below is a table of the IUPAC Nucleotide Code.
1099 The following table is table 1 from "Nomenclature for Incompletely
1100 Specified Bases in Nucleic Acid Sequences" which can be found at
1101 http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.
1103 ====== ================= ===================================
1104 Symbol Meaning Origin of designation
1105 ====== ================= ===================================
1114 S G or C Strong interaction (3 H bonds)
1115 W A or T Weak interaction (2 H bonds)
1116 H A or C or T not-G, H follows G in the alphabet
1117 B G or T or C not-A, B follows A
1118 V G or C or A not-T (not-U), V follows U
1119 D G or A or T not-C, D follows C
1120 N G or A or T or C aNy
1121 ====== ================= ===================================
1124 .. Define links below
1127 .. _GPL: http://www.opensource.org/licenses/gpl-license.php
1128 .. _wiki: http://mussa.caltech.edu
1129 .. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
1130 .. _FASTA: http://en.wikipedia.org/wiki/fasta_format
1131 .. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif