8 Last updated: Oct 16th, 2006
10 Updated to Mussagl build: 287? (In process to 424)
14 * New features / change log
15 * Comment out anything isn't implemented yet.
16 * (DONE) List of features that will be implemented in the future.
17 * Look into the homology mapping of UCSC.
18 * Add toggle to genomes.
19 * Document why one fast record per region.
20 * How to deal with the hazards of small utrs vis motif finder. (Add warning)
21 * Add warning about saving FASTA file.
22 * Add a general principles section near the top
23 * Using comparison algorithm which will pickup all repeats
24 * Add info about repeatmasking
25 * Checking upstream and downstream genes for make sure you are in the right regions.
26 * Later on: look into Ensembl
27 * Look into method of homology instead of blating.
28 * Mention advantages of using mupa.
29 * Mention the difference between using arrows and scroll bar
30 * Document the color for motifs
31 * Update for Mac user left-click
33 * Wormbase/Flybase/mirBASE tutorials
46 * Analysis "Save As" feature
51 .. INSERT CHANGE LOG HERE
52 .. END INSERT CHANGE LOG
54 Features to be Implemented
55 --------------------------
57 * Motif editor supporting more than 10 motifs
58 (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/122)
59 * Save motifs from Mussagl
60 (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/133)
62 For an up-to-date list of features to be implemented visit:
63 http://woldlab.caltech.edu/cgi-bin/mussa/roadmap
72 Mussa is an N-way version of the FamilyRelations (which is a part of
73 the Cartwheel project) 2-way comparative sequence analysis
74 software. Given DNA sequence from N species, Mussa uses all possible
75 pairwise comparions to derive an N-wise comparison. For example, given
76 sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
77 1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
78 these comparisons, saving those that satisfy a transitivity
79 requirement. The saved paths are then displayed in an interactive
82 Short History of Mussa
83 ----------------------
85 Mussa Python/PMW Prototype
86 ~~~~~~~~~~~~~~~~~~~~~~~~~~
88 First Python/PMW based protoype.
93 A rewrite for speed purposes using C++ and FLTK GUI toolkit.
98 Refactored version using the more elegant Qt GUI framework and
99 OpenGL for hardware acceleration for those who have better graphics
108 Mussagl has been released open source under the `GPL v2
116 You have the option of building from source or downloading prebuilt
117 binaries. Most people will want the prebuilt versions.
121 * Mac OS X (binary or source)
122 * Windows XP (binary or source)
128 Mussagl in binary form for OS X and Windows and/or source can be
129 downloaded from http://mussa.caltech.edu/.
136 Once you have downloaded the .dmg file, double click on it and follow
137 the install instructions.
139 FIXME: Mention how to launch the program.
144 Once you have downloaded the Mussagl installer, double click on the
145 installer and follow the install instructions.
147 To start Mussagl, launch the program from Start > Programs > Mussagl >
153 Currently we do not have a binary installer for Linux. You will have
154 to build from source. See the 'build from source' section below.
160 Instructions for building from source can be found `build page
161 <http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild>`_ on the
170 If you already have your data, you can skip ahead to the the `Using
173 Let's say you have a gene of interest called 'SMN1' and you want to
174 know how the sequence surrounding the gene in multiple species is
175 conserved. Guess what, that's what we are going to do, retrieve the
176 DNA sequence for SMN1 and prepare it for using in Mussa.
178 For more information about SMN1 visit `NCBI's OMIM
179 <http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
181 The SMN1 data retrieved in this section can be downloaded from the
183 <http://woldlab.caltech.edu/cgi-bin/mussa/wiki/ExampleData>`_ page if
184 you prefer to skip this section of the manual.
187 UCSC Genome Browser Method
188 --------------------------
190 There are many methods of retrieving DNA sequence, but for this
191 example we will retrieve SMN1 through the UCSC genome browser located
192 at http://genome.ucsc.edu/.
195 .. image:: images/ucsc_genome_browser_home.png
196 :alt: UCSC Genome Browser
202 The first step in finding SMN1 is to use the **Gene Sorter** menu
203 option which I have highlighted in orange below:
205 .. image:: images/ucsc_menu_bar_gene_sorter.png
206 :alt: Gene Sorter Menu Option
211 .. image:: images/ucsc_gene_sorter.png
215 We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
217 .. image:: images/ucsc_gs_sort_name_sim.png
218 :alt: Gene Sorter - Name Similarity
221 After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
223 .. image:: images/ucsc_gs_smn1.png
227 Press **Go!** and you should see the following page:
229 .. image:: images/ucsc_gs_found.png
233 Click on **SMN1** and you will be taking the gene expression atlas
236 .. image:: images/ucsc_gs_genome_position.png
237 :alt: Gene expression atlas
240 Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
243 Now we have found the location of SMN1 on human!
245 .. image:: images/ucsc_gb_smn1_human.png
246 :alt: Genome Browser - SMN1 (human)
250 Step 2 - Download CDS/UTR sequence for annotations
251 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
253 Since we have found **SMN1**, this would be a convenient time to extract
254 the DNA sequence for the CDS and UTRs of the gene to use it as an
255 annotation_ in Mussa.
257 **Click on SMN1** shown **between** the **two orange arrows** shown
260 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
261 :alt: Genome Browser - SMN1 (human) - Orange Arrows
264 You should find yourself at the SMN1 description page.
266 .. image:: images/ucsc_gb_smn1_description_page.png
267 :alt: Genome Browser - SMN1 (human) - Description page
270 **Scroll down** until you get to the **Sequence section** and click on
271 **Genomic (chr5:70,256,524-70,284,592)**.
273 .. image:: images/ucsc_gb_smn1_human_sequence.png
274 :alt: Genome Browser - SMN1 (human) - Sequence
277 You should now be at the **Genomic sequence near gene** page:
279 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
280 :alt: Genome Browser - SMN1 (human) - Get genomic sequence
283 Make the following changes (highlighted in orange in the screenshot
286 1. UNcheck **introns**.
287 (We only want to annotate CDS and UTRs.)
288 2. Select **one FASTA record** per **region**.
289 (Mussa needs each CDS and UTR represented by one FASTA record per CDS/UTR).
290 3. Select **CDS in upper case, UTR in lower case.**
292 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
293 :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
296 Now click the **submit** button. You will then see a FASTA file with
297 many FASTA records representing the CDS and UTRS.
299 .. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
300 :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
303 Now you need to save the FASTA records to a **text file**. If you are
304 using **Firefox** or **Internet Explorer 6+** click on the **File >
305 Save As** menu option.
307 **IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
308 repeat **NOT Webpage Complete** (see screenshot below.)
310 Type in **smn1_human_annot.txt** for the file name.
312 .. image:: images/smn1_human_annot.png
313 :alt: Genome Browser - SMN1 (human) - sequence annotation file
316 **IMPORTANT:** You should open the file with a text editor and make
317 sure **no HTML** was saved... If you find any HTML markup, delete
318 the markup and save the file.
320 Now we are going to **modify the file** you just saved to **add the
321 name of the species** to the **annotation file**. All you have to do
322 is **add a new line** at the **top of the file** with the word **'Human'** as
325 .. image:: images/smn1_human_annot_plus_human.png
326 :alt: Genome Browser - SMN1 (human) - sequence annotation file
329 You can add more annotations to this file if you wish. See the
330 `annotation file format`_ section for details of the file format. By
331 including FASTA records in the annotation_ file, Mussa searches your
332 DNA sequence for an exact match of the sequence in the annotation_
333 file. If found, it will be marked as an annotation_ within Mussa.
336 Step 3 - Download gene and upstream/downstream sequence
337 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
339 Use the back button in your web browser to get back the **genome
340 browser view** of **SMN1** as shown below.
342 .. image:: images/ucsc_gb_smn1_human.png
343 :alt: Genome Browser - SMN1 (human)
346 There are two options for getting additional sequence around your
347 gene. The more complex way is to zoom out so that you have the
348 sequence you want being shown in the genome browser and then follow
349 the directions for the following method.
351 The second option, which we will choose, is to leave the genome
352 browser zoomed exactly at the location of SMN1 and click on the
353 **DNA** option on the menu bar (shown with orange arrows in the
356 .. image:: images/ucsc_gb_smn1_human_dna_option.png
357 :alt: Genome Browser - SMN1 (human) - DNA Option
360 Now in the **get dna in window** page, let's add an arbitrary amount of
361 extra sequence on to each end of the gene, let's say 5000 base pairs.
363 .. image:: images/ucsc_gb_smn1_human_get_dna.png
364 :alt: Genome Browser - SMN1 (human) - Get DNA
367 Click the **get DNA** button.
369 .. image:: images/ucsc_gb_smn1_human_dna.png
370 :alt: Genome Browser - SMN1 (human) - DNA
373 Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
374 did in step 2 with the annotation file.
376 **IMPORTANT:** Make sure the file is saved as a text file and not an
377 HTML file. Open the file with a text editor and remove any HTML markup
381 Step 4 - Same/similar/related gene other species.
382 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
384 What good is a multiple sequence alignment viewer without multiple
385 sequences? Let'S find a similar gene in a few more species.
387 Use the back button on your web browser until you get the **genome
388 browser view** of **SMN1** as shown below.
390 .. image:: images/ucsc_genome_browser_home.png
391 :alt: UCSC Genome Browser
394 **Click on SMN1** shown **between** the **two orange arrows** shown
397 .. image:: images/ucsc_gb_smn1_human_click_smn1.png
398 :alt: Genome Browser - SMN1 (human) - Orange Arrows
401 You should find yourself at the SMN1 description page.
403 .. image:: images/ucsc_gb_smn1_description_page.png
404 :alt: Genome Browser - SMN1 (human) - Description page
407 **Scroll down** until you get to the **Sequence section** and click on
408 **Protein (262 aa)**.
410 .. image:: images/ucsc_gb_smn1_human_sequence.png
411 :alt: Genome Browser - SMN1 (human) - Sequence
414 Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
415 > Copy** option from the menu.
417 .. image:: images/smn1_human_protein.png
418 :alt: Genome Browser - SMN1 (human) - Protein
421 Press the back button on the web browser once and then scroll to the
422 top of the page and click on the **BLAT** option on the menu bar
423 (shown below with orange arrows).
425 .. image:: images/ucsc_gb_smn1_human_blat.png
426 :alt: Genome Browser - SMN1 (human) - Blat
429 **Paste** in the **protein sequence** and **change** the **genome** to
430 **mouse** as shown below and then click **submit**.
432 .. image:: images/ucsc_gb_smn1_human_blat_paste.png
433 :alt: Genome Browser - SMN1 (human) - Blat paste protein
436 Notice that we have two hits, one of which looks pretty good at 89.9%
439 .. image:: images/ucsc_gb_smn1_human_blat_hits.png
440 :alt: Genome Browser - SMN1 (human) - Blat hits
443 **Click** on the **brower** link next to the 89.9% match. Notice in
444 the genome browser (shown below) that there is an annotated gene
445 called SMN1 for mouse which matches the line called **your sequence
446 from blat search**. This means we are fairly confidant we found the
447 right location in the mouse genome.
449 .. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
450 :alt: Genome Browser - SMN1 (human) - Blat to browser
453 Follow steps 1 through 3 for mouse and then repeat step 4 with the
454 human protein sequence to find **SMN1** in the following species (if
465 Make sure to save the extended DNA sequence and annotation file for
474 Launch Mussagl... It should look similar to the screen shot below.
476 .. image:: images/opened.png
483 ----------------------
485 Currently there are three ways to load a Mussa experiment.
487 1. `Create a new analysis`_
488 2. `Load a mussa parameter file`_ (.mupa)
489 3. `Load an analysis`_
493 Create a new analysis
494 ~~~~~~~~~~~~~~~~~~~~~
496 To create a new analysis select 'Define analysis' from the 'File'
497 menu. You should see a dialog box similar to the one below. For this
498 demo we will use the example sequences that come with Mussagl.
500 .. image:: images/define_analysis.png
501 :alt: Define Analysis
506 1. **Give the experiment a name**, for this demo, we'll use
507 'demo_w30_t20'. Mussa will create a folder with this name to store
508 the analysis files in once it has been run.
510 2. Choose a `window size`_. For this demo **choose 30**.
512 3. Choose a threshold_... for this demo **choose 20**. See the
513 Threshold_ section for more detailed information.
515 4. Choose the number of sequences_ you would like. For this demo
518 .. image:: images/define_analysis_step1a.png
522 Now click on the 'Browse' button next to the sequence input box and
523 then select /examples/seq/human_mck_pro.fa file. Do the same in the
524 next two sequence input boxes selecting mouse_mck_pro.fa and
525 rabbit_mck_pro.fa as shown below. Note that you can create annotation
526 files using the mussa `Annotation File Format`_ to add annotations to
529 .. image:: images/define_analysis_step2.png
530 :alt: Choose sequences
533 Click the **create** button and in a few moments you should see
534 something similar to the following screen shot.
536 .. image:: images/demo.png
540 This analysis is now saved in a directory called **demo_w30_t20** in
541 the current working directory. If you close and reopen Mussagl, you
542 can reload the saved analysis. See `Load an analysis`_ section below
546 Load a mussa parameter file
547 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~
549 If you prefer, you can define your Mussa analysis using the Mussa
550 parameter file. See the `Parameter File Format`_ section for details
551 on creating a .mupa file.
553 Once you have a .mupa file created, load Mussagl and select the **File >
554 Load Mussa Parameters** menu option. Select the .mupa file and click
557 .. image:: images/load_mupa_menu.png
558 :alt: Load Mussa Parameters
561 If you would like to see an example, you can load the
562 **mck3test.mupa** file in the examples directory that comes with
565 .. image:: images/load_mupa_dialog.png
566 :alt: Load Mussa Parameters Dialog
573 To load a previously run analysis open Mussagl and select the **File >
574 Load Analysis** menu option. Select an analysis **directory** and
577 .. image:: images/load_analysis_menu.png
578 :alt: Load Analysis Menu
587 .. Screen-shot with numbers showing features.
589 .. image:: images/window_overview.png
595 1. `DNA Sequence (Black bars)`_
601 4. `Red conservation tracks`_
603 5. `Blue conservation tracks`_
605 6. `Zoom Factor`_ (Base pairs per pixel)
607 7. `Dynamic Threshold`_
609 8. `Sequence Information Bar`_
611 9. `Sequence Scroll Bar`_
614 DNA Sequence (black bars)
615 ~~~~~~~~~~~~~~~~~~~~~~~~~
617 .. image:: images/sequence_bar.png
621 Each of the black bars represents one of the loaded sequences, in this
622 case the sequence around the gene 'MCK' in human, mouse, and rabbit.
628 .. figure:: images/annotation.png
632 Annotation shown in green on sequence bar.
635 Annotations can be included on any of the sequences using the `Load a
636 mussa parameter file`_ or `Create a new analysis`_ method of loading
637 your sequences. You can define annotations by location or using an
638 exact sub-sequence or a FASTA sequence of the section of DNA you wish
639 to annotate. See the `Annotation File Format`_ section for details.
645 .. figure:: images/motif.png
649 Motif shown in light blue on sequence bar.
651 The only real difference between an annotation and motif in Mussagl is
652 that you can define motifs and choose a color from within the GUI. See
653 the `Motifs`_ section for more information.
656 Red conservation tracks
657 ~~~~~~~~~~~~~~~~~~~~~~~
659 .. figure:: images/conservation_tracks.png
660 :alt: Conservation Tracks
663 Conservations tracks shown as red and blue lines between sequence
666 The **red lines** between the sequence bars represent conservation
667 between the sequences (i.e. not reverse complement matches)
669 The amount of sequence conservation shown will depend on how much your
670 sequences are related and the `dynamic threshold`_ you are using.
673 Blue conservation tracks
674 ~~~~~~~~~~~~~~~~~~~~~~~~
676 .. figure:: images/conservation_tracks.png
677 :alt: Conservation Tracks
680 Conservations tracks shown as red and blue lines between sequence
683 **Blue lines** represent **reverse complement** conservation relative
684 to the sequence attached to the top of the blue line.
686 The amount of sequence conservation shown will depend on how much your
687 sequences are related and the `dynamic threshold`_ you are using.
693 .. image:: images/zoom_factor.png
697 The zoom factor represents the number of base pairs represented per
698 pixel. When you zoom in far enough the sequence will switch from
699 seeing a black bar, representing the sequence, to the actual sequence
700 (well, ASCII representation of sequence).
706 .. image:: images/dynamic_threshold.png
707 :alt: Dynamic Threshold
710 You can dynamically change the threshold for how strong a match you
711 consider the conservation to be by changing the value in the dynamic
714 The value you enter is the minimum number of base pairs that have to
715 be matched in order to be considered conserved. The second number that
716 you can't change is the `window size`_ you used when creating the
717 experiment. The last number is the percent match.
719 See the Threshold_ section for more information.
722 Sequence Information Bar
723 ~~~~~~~~~~~~~~~~~~~~~~~~
725 .. image:: images/seq_info_bar.png
726 :alt: Sequence Information Bar
729 The sequence information bars can be found to the left and right sides
730 of Mussagl. Next to each sequence you will find the following
733 1. Species (If it has been defined)
734 2. Total Size of Sequence
735 3. Current base pair position
737 Note that you can **update the species** text box. Make sure to **save your
738 experiment** after making this change by selecting **File > Save
739 Analysis** from the menu.
744 .. image:: images/scroll_bar.png
745 :alt: Sequence Scroll Bar
748 The scroll bar allows you to scroll through the sequence which is
749 useful when you have zoomed in using the `zoom factor`_.
758 Currently annotations can be added to a sequence using the mussa
759 `annotation file format`_ and can be loaded by selecting the
760 annotation file when defining a new analysis (see `Create a new
761 analysis`_ section) or by defining a .mupa file pointing to your
762 annotation file (see `Load a mussa parameter file`_ section).
767 Load Motifs from File
768 *********************
770 It is possible to load motifs from a file which was saved from a
771 previous run or by defining your own motif file. See the `Motif File
772 Format`_ section for details.
774 NOTE: Valid motif list file extensions are:
779 To load a motif file, select **Load Motif List** item from the
780 **File** menu and select a motif list file.
782 .. image:: images/load_motif.png
783 :alt: Load Motif List
790 Note: Currently not implemented
799 * Allow for toggling individual motifs on and off.
802 * Field added for naming motifs.
804 Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
805 Code`_ for defining a motif. To define a motif, select **Edit > Edit
806 Motifs** menu item as shown below.
808 .. image:: images/view_edit_motifs.png
809 :alt: "View > Edit Motifs" Menu
812 You will see a dialog box appear with a "set motifs" button and 10
813 rows for defining motifs and the color that will be displayed on the
814 sequence. By default all 10 motifs start off as with white as the
815 color. In the image below, I changed the color from white to blue to
816 make it easier to see. The first text box is for the motif and the
817 second box is for the name of the motif. The check box defines whether
818 the motif is displayed or not.
820 .. image:: images/motif_dialog_start.png
824 Now let's make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
825 Code`_, type in **'ATSCT'** into the first box and 'My Motif' for the
826 name in the second box as shown below.
828 .. image:: images/motif_dialog_enter_motif.png
832 Now choose a color for your motif by clicking on the colored area to
833 the left of the motif. In the image above, you would click on the blue
834 square, but by default the squares will be white. Remember to choose a
835 color that will show up well with a black bar as the background.
837 .. image:: images/color_chooser.png
841 Once you have selected the color for your motif, click on the 'set
842 motifs' button. Notice that if Mussa finds matches to your motif will
843 now show up in the main Mussagl window.
847 .. image:: images/motif_dialog_bar_before.png
848 :alt: Sequence bar before motif
853 .. image:: images/motif_dialog_bar_after.png
854 :alt: Sequence bar after motif
858 View Mussa Alignments
859 ---------------------
861 Mussagl allows you to zoom in on Mussa alignments by selecting the set
862 of alignment(s) of interest. To do this, move the mouse near the
863 alignment you are interested in viewing and then **PRESS** and
864 **HOLD** the **LEFT mouse button** and **drag the mouse** to the other
865 side of the conservation track so that you see a bounding box
866 overlaping the alienment(s) of interest and then **let go** of the
869 In the example below, I started by left-clicking on the area marked by
870 a red dot (upper left corner of bounding box) and dragging the mouse to
871 the area marked by a blue dot (lower right corner of the bounding box)
872 and letting go of the left mouse button.
874 .. image:: images/select_sequence.png
875 :alt: Select Sequence
878 All of the lines which were not selected should be washed out as shown
881 .. image:: images/washed_out.png
882 :alt: Tracks washed out
885 With a selection made, goto the **View** menu and select **View mussa alignment**.
887 .. image:: images/view_mussa_alignment.png
888 :alt: View mussa alignment
891 You should see the alignment at the base-pair level as shown below.
893 .. image:: images/mussa_alignment.png
894 :alt: Mussa alignment
901 To run a sub-analysis **highlight** a section of sequence and *right
902 click* on it and select **Add to subanalysis**. To the same for the
903 sequences shown in orange in the screenshot below. Note that you **are
904 NOT limited** to selecting more than one subsequence from the same
907 .. image:: images/subanalysis_select_seqs.png
908 :alt: Subanalysis sequence selection
911 Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
913 .. image:: images/subanalysis_dialog.png
914 :alt: Subanalysis Dialog
917 A new Mussa window will appear with the subanalysis of your sequences
918 once it's done running. This may take a while if you selected large
919 chunks of sequence with a loose threshold.
921 .. image:: images/subanalysis_done.png
922 :alt: Subalaysis complete
926 Copying sequence to clipboard
927 -----------------------------
929 To copy a sequence to the clipboard, highlight a section of sequence,
930 as shown in the screen shot below, and do one of the following:
932 * Select **Copy as FASTA** from the **Edit** menu.
933 * **Right-Click (Left-click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as FASTA**.
934 * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
936 .. image:: images/copy_sequence.png
941 ---------------------------------
943 * Updated to build 419.
945 To save your current mussa view to an image, select **File > Save to
946 image...** as shown below.
948 .. image:: images/save_to_image_menu.png
949 :alt: File > Save to image...
952 You can define the width and the height of the image to save. By
953 default it will use the same size of your current view. Since the
954 Mussa view is implemented using vectors, if you choose a larger size
955 then your current view, Mussa will redraw at the higher resolution
956 when saving. In other words, you get higher quality images when saving
957 at a higher resolution.
959 If you check the "Lock aspect ratio" check box, which I have circled
960 in red, then when you change one value, say width, the other, height,
961 will update automatically to keep the same aspect ratio.
963 .. image:: images/save_to_image_dialog.png
964 :alt: Save to image dialog
967 Click save and choose a location and filename for your file.
969 The valid image formats are:
971 * .png (default if no extension specified.)
981 The threshold of an analysis is in minimum number of base pair matches
982 must be meet to in order to be kept as a match. Note that you can vary
983 the threshold from within Mussagl. For example, if you choose a
984 `window size`_ of **30** and a **threshold** of **20** the mussa nway
985 transitive algorithm will store all matches that are 20 out of 30 bp
986 matches or better and pass it on to Mussagl. Mussagl will then allow
987 you to dynamically choose a threshold from 20 to 30 base pairs. A
988 threshold of 30 bps would only show 30 out of 30 bp matches. A
989 threshold of 20 bps would show all matches of 20 out of 30 bps or
990 better. If you would like to see results for matches lower than 20 out
991 of 30, you will need to rerun the analysis with a lower threshold.
996 The typical sizes people tend to choose are between 20 and 30. You
997 will likely need to experiment with this setting depending on your
998 needs and input sequence.
1004 Mussa reads in sequences which are formatted in the FASTA_
1005 format. Mussa may take a long time to run (>10 minutes) if the total
1006 bp length near 280Kb. Once mussa has run once, you can reload
1007 previously run analyzes.
1009 FIXME: We have learned more about how much sequence and how many to
1010 put in Mussagl, this information should be documented here.
1018 Parameter File Format
1019 ~~~~~~~~~~~~~~~~~~~~~
1021 **File Format (.mupa):**
1025 # name of analysis directory and stem for associated files
1026 ANA_NAME <analysis_name>
1028 # if APPEND vars true, a _wXX and/or _tYY added to analysis name
1029 # where XX = WINDOW and YY = THRESHOLD
1030 # Highly recommeded with use of command line override of WINDOW or THRESHOLD
1031 APPEND_WIN <true/false>
1032 APPEND_THRES <true/false>
1034 # how many sequences are being analyzed
1037 # first sequence info
1038 SEQUENCE <FASTA_file_path>
1039 ANNOTATION <annotation_file_path>
1040 SEQ_START <sequence_start>
1042 # the second sequence info
1043 SEQUENCE <FASTA_file_path>
1044 # ANNOTATION <annotation_file_path>
1045 SEQ_START <sequence_start>
1046 # SEQ_END <sequence_end>
1048 # third sequence info
1049 SEQUENCE <FASTA_file_path>
1050 # ANNOTATION <annotation_file_path>
1052 # analyzes parameters: command line args -w -t will override these
1056 .. csv-table:: Parameter File Options:
1057 :header: "Option Name", "Value", "Default", "Required", "Description"
1058 :widths: 30 30 30 30 60
1060 "ANA_NAME", "string", "N/A", "true", "Name of analysis (Also
1061 name of directory where analysis will be saved."
1062 "APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
1063 "APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
1064 "SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
1066 "SEQUENCE", "/FASTA/filepath.fa", "N/A", "true", "Must define one
1067 sequence per SEQUENCE_NUM."
1068 "ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
1069 annotation file. See `annotation file format`_ section for more
1071 "SEQ_START", "integer", "1", "false", "Optional index into FASTA file"
1072 "SEQ_END", "integer", "1", "false", "Optional index into FASTA file"
1073 "WINDOW", "integer", "N/A", "true", "`Window Size`_"
1074 "THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
1078 Annotation File Format
1079 ~~~~~~~~~~~~~~~~~~~~~~
1081 The first line in the file is the sequence name. Each line there after
1082 is a **space** separated annotation.
1084 New as of build 198:
1086 * The annotation format now supports FASTA sequences embedded in the
1087 annotation file as shown in the format example below. Mussagl will
1088 take this sequence and look for an exact match of this sequence in
1089 your sequences. If a match is found, it will label it with the name
1090 of from the FASTA header.
1096 <species/sequence_name>
1097 <start> <stop> <annotation_name> <annotation_type>
1098 <start> <stop> <annotation_name> <annotation_type>
1099 <start> <stop> <annotation_name> <annotation_type>
1100 <start> <stop> <annotation_name> <annotation_type>
1102 ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
1103 ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
1104 TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
1105 ACGTACGGCAGTACGCGGTCAGA
1106 <start> <stop> <annotation_name> <annotation_type>
1114 251 500 Glorp Glorptype
1115 751 1000 Glorp Glorptype
1116 1251 1500 Glorp Glorptype
1117 >My favorite DNA sequence
1119 1751 2000 Glorp Glorptype
1122 .. _motif_file_format:
1129 <motif> <red> <green> <blue>
1137 IUPAC Nucleotide Code
1138 ~~~~~~~~~~~~~~~~~~~~~~
1140 For your convenience, below is a table of the IUPAC Nucleotide Code.
1142 The following table is table 1 from "Nomenclature for Incompletely
1143 Specified Bases in Nucleic Acid Sequences" which can be found at
1144 http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.
1146 ====== ================= ===================================
1147 Symbol Meaning Origin of designation
1148 ====== ================= ===================================
1157 S G or C Strong interaction (3 H bonds)
1158 W A or T Weak interaction (2 H bonds)
1159 H A or C or T not-G, H follows G in the alphabet
1160 B G or T or C not-A, B follows A
1161 V G or C or A not-T (not-U), V follows U
1162 D G or A or T not-C, D follows C
1163 N G or A or T or C aNy
1164 ====== ================= ===================================
1167 .. Define links below
1170 .. _GPL: http://www.opensource.org/licenses/gpl-license.php
1171 .. _wiki: http://mussa.caltech.edu
1172 .. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
1173 .. _FASTA: http://en.wikipedia.org/wiki/fasta_format
1174 .. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif