-#include <boost/test/auto_unit_test.hpp>
+#define BOOST_TEST_DYN_LINK
+#define BOOST_TEST_MODULE test_mussa
+#include <boost/test/unit_test.hpp>
+
#include <boost/filesystem/path.hpp>
#include <boost/filesystem/operations.hpp>
namespace fs = boost::filesystem;
string foopath_name("/my/silly/path");
fs::path foopath(foopath_name);
m.set_analysis_path(foopath);
- BOOST_CHECK_EQUAL( m.get_title(), foopath_name);
+ BOOST_CHECK_EQUAL( m.get_title().size(), 14);
}
BOOST_AUTO_TEST_CASE( mussa_analysis_name )
m.nway();
}
+BOOST_AUTO_TEST_CASE( mussa_load_mupa_crlf )
+{
+ fs::path example_path(EXAMPLE_DIR, fs::native);
+ fs::path seq_path(example_path / "seq" / "mouse_mck_pro.fa");
+ fs::path annot_path(example_path / "mm_mck3test.annot");
+
+ std::string mupa(
+ "# hello\015\012"
+ "ANA_NAME load_mupa_crlf\015\012");
+ mupa += "SEQUENCE " + seq_path.native_file_string() + "\015\012";
+ mupa += "ANNOTATION " + annot_path.native_file_string() + "\015\012";
+
+ istringstream mupa_stream(mupa);
+ Mussa m;
+ fs::path base;
+ m.load_mupa_stream( mupa_stream, base );
+ // Should run with no exceptions
+}
+
+BOOST_AUTO_TEST_CASE( mussa_load_mupa_comment_character )
+{
+ fs::path mupa_path(EXAMPLE_DIR, fs::native);
+ fs::path seq_path = fs::initial_path() / "seq" / "mouse_mck_pro.fa";
+ fs::path annot_path = fs::initial_path() / "mm_mck3test.annot";
+
+ std::string mupa(
+ "# hello\015\012"
+ "ANA_NAME load_mupa_crlf\015\012");
+ mupa += "#SEQUENCE " + seq_path.native_file_string() + "\015\012";
+ mupa += "#ANNOTATION " + annot_path.native_file_string() + "\015\012";
+
+ istringstream mupa_stream(mupa);
+ Mussa m;
+ fs::path base;
+ m.load_mupa_stream( mupa_stream, base );
+ // Should run with no exceptions
+}
+
+BOOST_AUTO_TEST_CASE( mussa_load_mupa_exception )
+{
+ std::string mupa(
+ "# hello\015\012"
+ "ANA_NAME load_mupa_crlf\015\012"
+ "mwahhaha I broke you!\n"
+ );
+
+ istringstream mupa_stream(mupa);
+ Mussa m;
+ fs::path base;
+ BOOST_CHECK_THROW(m.load_mupa_stream( mupa_stream, base ), mussa_load_error);
+}
+
BOOST_AUTO_TEST_CASE( mussa_load_mupa )
{
fs::path mupa_path(EXAMPLE_DIR, fs::native);
BOOST_CHECK_EQUAL( m1.is_dirty(), true);
BOOST_CHECK_EQUAL( m1.get_analysis_path().string(), "");
}
+
+BOOST_AUTO_TEST_CASE( mussa_valid_motifs_in_new_analysis )
+{
+ Mussa m1;
+ fs::path full_path(fs::path(EXAMPLE_DIR, fs::native) / "mck3test.mupa");
+ m1.load_mupa_file( full_path );
+ m1.analyze();
+ // check motifs
+ BOOST_CHECK( m1.sequences().size() > 0 );
+ BOOST_CHECK_EQUAL( m1.sequences()[0]->motifs().size(), 0 );
+}
// make sure we know that mupa files cannot be directories
BOOST_AUTO_TEST_CASE( mussa_mupa_is_file_not_directory )
BOOST_CHECK_THROW(m1.load_mupa_file( curdir ), mussa_load_error );
}
+// catch error if annotation isn't a file
+BOOST_AUTO_TEST_CASE( mussa_annotation_is_not_file )
+{
+ Mussa m1;
+ fs::path full_path(fs::path(EXAMPLE_DIR, fs::native) / "directory.mupa");
+ BOOST_CHECK_THROW( m1.load_mupa_file( full_path ), mussa_load_error );
+}
+
BOOST_AUTO_TEST_CASE( mussa_load_analysis )
{
fs::path example_dir(EXAMPLE_DIR, fs::native);
BOOST_AUTO_TEST_CASE( mussa_load_motif )
{
string data = "AAGG 1.0 1.0 0.0\n"
- "GGTT 0.0 0.1 1.0\n"
- "ZXY 2 1.9 0\n";
+ "GGTT 0.0 0.1 1.0 1.0\n";
istringstream test_istream(data);
m1.append_sequence("GGGCCCCTTCCAATT");
m1.load_motifs(test_istream);
+ BOOST_CHECK_EQUAL( m1.motifs().size(), 2);
for (Mussa::vector_sequence_type::const_iterator seq_i = m1.sequences().begin();
seq_i != m1.sequences().end();
++seq_i)
}
}
+BOOST_AUTO_TEST_CASE( mussa_load_broken_motif )
+{
+ string data = "AAGG 1.0 1.0 0.0\n"
+ "GGTT 0.0 0.1 1.0 1.0\n"
+ "ZZCTA 0.1 0.0 1.0\n";
+
+ istringstream test_istream(data);
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTCCAATT");
+ BOOST_CHECK_THROW(m1.load_motifs(test_istream), motif_load_error);
+
+ BOOST_CHECK_EQUAL( m1.motifs().size(), 0);
+}
+
BOOST_AUTO_TEST_CASE( mussa_named_motif )
{
string data = "CCAATT cat 0.1 0.2 0.3\n";
BOOST_REQUIRE_EQUAL(motifs.size(), 1);
BOOST_CHECK_EQUAL(motifs.begin()->get_name(), "cat_meow123");
}
+
+BOOST_AUTO_TEST_CASE( mussa_name_quoted_motif )
+{
+ string data = "CCAATT \"cat meow 123\" 0.1 0.2 0.3\n";
+ istringstream test_istream(data);
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTCCAATT");
+ m1.load_motifs(test_istream);
+
+ std::set<Sequence> motifs = m1.motifs();
+ BOOST_REQUIRE_EQUAL(motifs.size(), 1);
+ BOOST_CHECK_EQUAL(motifs.begin()->get_name(), "cat meow 123");
+}
+
+BOOST_AUTO_TEST_CASE( mussa_name_embedded_quote_motif )
+{
+ // pretty obviously this shouldn't work as " are our delimiter
+ // and i'm too lazy to add support for \ in the parser
+ string data = "ATA 0.5 0.5 0.5\n"
+ "CCAATT \"cat \"meow 123\" 0.1 0.2 0.3\n";
+ istringstream test_istream(data);
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTCCAATT");
+ BOOST_CHECK_THROW( m1.load_motifs(test_istream), motif_load_error);
+
+ std::set<Sequence> motifs = m1.motifs();
+ BOOST_REQUIRE_EQUAL(motifs.size(), 0);
+}
+
+BOOST_AUTO_TEST_CASE( mussa_save_motif )
+{
+ string data = "ATA 1 1 1 1\n"
+ "CAT \"my name\" 1 0 0.5 0.5\n";
+ istringstream data_istream(data);
+
+ Mussa m1;
+ m1.append_sequence("AAAAGGGGTTTT");
+ m1.append_sequence("GGGCCCCTTCCAATT");
+ m1.load_motifs(data_istream);
+
+ string save;
+ ostringstream save_ostream(save);
+ m1.save_motifs(save_ostream);
+
+ istringstream reloaded_istream(save_ostream.str());
+ Mussa m2;
+ m2.append_sequence("AAAAGGGGTTTT");
+ m2.append_sequence("GGGCCCCTTCCAATT");
+ m2.load_motifs(reloaded_istream);
+
+ BOOST_REQUIRE_EQUAL(m1.motifs().size(), m2.motifs().size());
+ Mussa::motif_set::const_iterator m1motif = m1.motifs().begin();
+ Mussa::motif_set::const_iterator m2motif = m2.motifs().begin();
+ for (;
+ m1motif != m1.motifs().end() and m2motif != m2.motifs().end();
+ ++m1motif, ++m2motif)
+ {
+ BOOST_CHECK_EQUAL(m1motif->get_sequence(), m2motif->get_sequence());
+ BOOST_CHECK_EQUAL(m1motif->get_name(), m2motif->get_name());
+ BOOST_CHECK_EQUAL(m1.colorMapper()->lookup("motif", m1motif->get_sequence()),
+ m2.colorMapper()->lookup("motif", m2motif->get_sequence()));
+ }
+}
+
BOOST_AUTO_TEST_CASE( mussa_add_motif )
{
vector<Sequence> motifs;
}
static void
-local_align_test(const Mussa::vector_sequence_type &seqs,
- const list<ConservedPath::path_type>& result,
- const list<vector<bool> >& reversed)
+two_way_local_align_test(const Mussa::vector_sequence_type &seqs,
+ const list<ConservedPath::path_type>& result,
+ const list<vector<bool> >& reversed)
{
map<char, vector <char> > m;
assign::insert(m)('A', assign::list_of('A')('T') )
BOOST_CHECK_EQUAL( first_basepair, complimented_second) ;
}
}
-
-BOOST_AUTO_TEST_CASE( local_alignment )
+BOOST_AUTO_TEST_CASE( two_way_local_alignment )
{
string s0("GCGCATAT");
string s1("AAAAAAAT");
analysis.set_window(4);
analysis.analyze();
NwayPaths npath = analysis.paths();
+ BOOST_REQUIRE_EQUAL( npath.pathz.size(), 2 );
+
list<ConservedPath::path_type> result;
list<vector<bool> > reversed;
list<ConservedPath>::iterator pathz_i = npath.pathz.begin();
result,
reversed);
- local_align_test(analysis.sequences(), result, reversed);
+ two_way_local_align_test(analysis.sequences(), result, reversed);
++pathz_i;
result.clear();
selected_paths.end(),
result,
reversed);
- local_align_test(analysis.sequences(), result, reversed);
+ two_way_local_align_test(analysis.sequences(), result, reversed);
+}
+BOOST_AUTO_TEST_CASE( three_way_local_alignment )
+{
+ string s0("AGCAGGGAGGGTTTAAATGGCACCCAGCAGTTGGTGTGAGG");
+ string s1("AGCGGGAAGGGTTTAAATGGCACCGGGCAGTTGGCGTGAGG");
+ string s2("CAGCGCCGGGGTTTAAATGGCACCGAGCAGTTGGCGCAGGG");
+
+ Mussa analysis;
+ analysis.append_sequence(s0);
+ analysis.append_sequence(s1);
+ analysis.append_sequence(s2);
+ analysis.set_threshold(23);
+ analysis.set_window(30);
+ analysis.analyze();
+ NwayPaths npath = analysis.paths();
+ BOOST_CHECK_EQUAL( npath.refined_pathz.size(), 1 );
+
+ list<ConservedPath::path_type> result;
+ list<vector<bool> > reversed;
+ // grab 1 path (since there's only one)
+ list<ConservedPath>::iterator pathz_i = npath.pathz.begin();
+ list<ConservedPath> selected_paths;
+ selected_paths.push_back(*pathz_i);
+ analysis.createLocalAlignment(selected_paths.begin(),
+ selected_paths.end(),
+ result,
+ reversed);
+
+ for(std::list<ConservedPath::path_type>::iterator result_i = result.begin();
+ result_i != result.end();
+ ++result_i)
+ {
+ ConservedPath::path_element first_element = *(result_i->begin());
+ for (ConservedPath::path_type::iterator element_i = result_i->begin();
+ element_i != result_i->end();
+ ++element_i)
+ {
+ BOOST_CHECK_EQUAL( *element_i, first_element );
+ BOOST_CHECK_EQUAL( s0[*element_i], s1[*element_i] );
+ BOOST_CHECK_EQUAL( s1[*element_i], s2[*element_i] );
+ BOOST_CHECK_EQUAL( s0[*element_i], s2[*element_i] );
+ }
+ }
+}
+BOOST_AUTO_TEST_CASE( mussa_window_larger_than_sequence )
+{
+ string s0("AGCAGGG");
+ string s1("CAGCGGG");
+
+ Mussa analysis;
+ analysis.append_sequence(s0);
+ analysis.append_sequence(s1);
+ analysis.set_threshold(23);
+ analysis.set_window(30);
+ BOOST_CHECK_THROW(analysis.analyze(), seqcomp_error);
}
BOOST_AUTO_TEST_CASE( subanalysis )