//BOOST_CHECK_EQUAL( annots
}
+
+BOOST_AUTO_TEST_CASE(annotation_ucsc_html_load)
+{
+ // this actually is basically what's returned by UCSC
+ // (well actually with some of the sequence and copies of fasta blocks
+ // removed to make the example shorter
+ string annot_data = "\n"
+ "<PRE>\n"
+ ">hg17_knownGene_NM_001824_0 range=chr19:50517919-50517974 5'pad=0 3'pad=0 revComp=TRUE strand=- repeatMasking=none\n"
+ "GGGTCAGTGTCACCTCCAGGATACAGACAG\n"
+ ">hg17_knownGene_NM_001824_3 range=chr19:50510563-50510695 5'pad=0 3'pad=0 revComp=TRUE strand=- repeatMasking=none\n"
+ "GGTGGAGACGACCTGGACCCTAACTACGT\n"
+ "</PRE>\n"
+ "\n"
+ "</BODY>\n"
+ "</HTML>\n"
+ ;
+
+ string s =
+ "TGGGTCAGTGTCACCTCCAGGATACAGACAGCCCCCCTTCAGCCCAGCCCAGCCAG"
+ "AAAAA"
+ "GGTGGAGACGACCTGGACCCTAACTACGTGCTCAGCAGCCGCGTCCGCAC";
+ Sequence seq(s);
+ seq.parse_annot(annot_data);
+ std::list<annot> annots = seq.annotations();
+ BOOST_CHECK_EQUAL( annots.size(), 2);
+}
+
BOOST_AUTO_TEST_CASE( annotation_load_no_species_name )
{
string annot_data = "0 10 name type\n"