+#define BOOST_AUTO_TEST_MAIN
#include <boost/test/auto_unit_test.hpp>
#include <boost/filesystem/path.hpp>
#include <boost/filesystem/operations.hpp>
namespace fs=boost::filesystem;
+#include <boost/algorithm/string/case_conv.hpp>
+
#include <list>
#include <iostream>
#include <sstream>
+#include <boost/archive/text_oarchive.hpp>
+#include <boost/archive/text_iarchive.hpp>
+#include <boost/archive/xml_oarchive.hpp>
+#include <boost/archive/xml_iarchive.hpp>
+
#include "alg/sequence.hpp"
#include "mussa_exceptions.hpp"
using namespace std;
+BOOST_AUTO_TEST_CASE( sequence_get_sequence )
+{
+ Sequence s;
+ // make sure that retrieving the sequence doesn't throw an error
+ BOOST_CHECK_EQUAL(s.get_sequence(), std::string() );
+}
+
+BOOST_AUTO_TEST_CASE( sequence_from_string )
+{
+ std::string str1("AAAT");
+ Sequence seq1(str1);
+ BOOST_CHECK_EQUAL(seq1.get_sequence(), str1);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_find_first_not_of )
+{
+ std::string str1("AAAAT");
+ Sequence seq1(str1);
+ BOOST_CHECK_EQUAL(seq1.find_first_not_of("A"), str1.find_first_not_of("A"));
+
+ std::string str2("AATTGGCC");
+ Sequence seq2(str2);
+ BOOST_CHECK_EQUAL(seq2.find_first_not_of("qwer"), str2.find_first_not_of("qwer"));
+}
+
//! when we try to load a missing file, do we get an error?
BOOST_AUTO_TEST_CASE( sequence_load_exception )
{
BOOST_CHECK_THROW( s.load_annot("alkejralk", 0, 0), mussa_load_error);
}
+BOOST_AUTO_TEST_CASE( sequence_eol_conventions )
+{
+ string header(">Header");
+ string line1("AAAAGGGGCCCCTTTTT");
+ string line2("AAAAGGGGCCCCTTTTT");
+ int seq_len = line1.size() + line2.size();
+
+ stringstream cr;
+ cr << header << "\015" << line1 << "\015" << line2 << "\015";
+ Sequence seq_cr;
+ seq_cr.load_fasta(cr);
+
+ stringstream crlf;
+ crlf << header << "\015\012" << line1 << "\015\012" << line2 << "\015\012";
+ Sequence seq_crlf;
+ seq_crlf.load_fasta(crlf);
+
+ stringstream lf;
+ lf << header << "\012" << line1 << "\012" << line2 << "\012";
+ Sequence seq_lf;
+ seq_lf.load_fasta(lf);
+
+ BOOST_CHECK_EQUAL(seq_cr.size(), seq_len);
+ BOOST_CHECK_EQUAL(seq_crlf.size(), seq_len);
+ BOOST_CHECK_EQUAL(seq_cr.size(), seq_len);
+}
+
+
//! Do simple operations work correctly?
BOOST_AUTO_TEST_CASE( sequence_filter )
{
- Sequence s1("AATTGGCC");
- BOOST_CHECK_EQUAL(s1.get_seq(), "AATTGGCC");
+ const char *core_seq = "AATTGGCC";
+ Sequence s1(core_seq, Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_EQUAL(s1, core_seq);
- Sequence s2("aattggcc");
- BOOST_CHECK_EQUAL(s2.get_seq(), "AATTGGCC");
+ Sequence s2("aattggcc", Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_EQUAL(s2, "AATTGGCC");
BOOST_CHECK_EQUAL(s2.rev_comp(), "GGCCAATT");
- BOOST_CHECK_EQUAL(s2.size(), s2.get_seq().size());
- BOOST_CHECK_EQUAL(s2.c_seq(), s2.get_seq().c_str());
+ BOOST_CHECK_EQUAL(s2.rev_comp(), "ggccaatt"); // we should be case insensitive now
+ BOOST_CHECK_EQUAL(s2.size(), s2.size());
+ //We're currently forcing sequences to uppercase
+ BOOST_CHECK_EQUAL(s2.get_sequence(), "AATTGGCC");
- Sequence s3("asdfg");
- BOOST_CHECK_EQUAL(s3.get_seq(), "ANNNG");
+ Sequence s3("asdfg", Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_EQUAL(s3, "ANNNG");
BOOST_CHECK_EQUAL(s3.subseq(0,2), "AN");
- s3.set_filtered_sequence("AAGGCCTT", 0, 2);
- BOOST_CHECK_EQUAL(s3.get_seq(), "AA");
- s3.set_filtered_sequence("AAGGCCTT", 2, 2);
- BOOST_CHECK_EQUAL( s3.get_seq(), "GG");
- s3.set_filtered_sequence("AAGGCCTT", 4);
- BOOST_CHECK_EQUAL( s3.get_seq(), "CCTT");
+ s3.set_filtered_sequence("AAGGCCTT", Sequence::reduced_dna_alphabet, 0, 2);
+ BOOST_CHECK_EQUAL(s3, "AA");
+ s3.set_filtered_sequence("AAGGCCTT", Sequence::reduced_dna_alphabet, 2, 2);
+ BOOST_CHECK_EQUAL( s3, "GG");
+ s3.set_filtered_sequence("AAGGCCTT", Sequence::reduced_dna_alphabet, 4);
+ BOOST_CHECK_EQUAL( s3, "CCTT");
+
+ s3 = "AAGGFF";
+ BOOST_CHECK_EQUAL(s3, "AAGGNN");
+}
+
+BOOST_AUTO_TEST_CASE( sequence_nucleic_alphabet )
+{
+ std::string agct("AGCT");
+ Sequence seq(agct, Sequence::nucleic_alphabet);
+ BOOST_CHECK_EQUAL(seq.size(), agct.size());
+ BOOST_CHECK_EQUAL(seq.get_sequence(), agct);
- s3.clear();
- BOOST_CHECK_EQUAL(s3.get_seq(), "");
+ std::string bdv("BDv");
+ Sequence seq_bdv(bdv, Sequence::nucleic_alphabet);
+ BOOST_CHECK_EQUAL(seq_bdv.size(), bdv.size());
+ // forcing sequence to upper case
+ BOOST_CHECK_EQUAL(seq_bdv.get_sequence(),
+ boost::algorithm::to_upper_copy(bdv));
+
+}
- s3.set_seq("AAGGFF");
- BOOST_CHECK_EQUAL(s3.get_seq(), "AAGGNN");
+BOOST_AUTO_TEST_CASE( sequence_default_alphabet )
+{
+ std::string agct("AGCT");
+ Sequence seq(agct);
+ BOOST_CHECK_EQUAL(seq.size(), agct.size());
+ BOOST_CHECK_EQUAL(seq.get_sequence(), agct);
+ BOOST_CHECK_EQUAL(seq[0], agct[0]);
+ BOOST_CHECK_EQUAL(seq[1], agct[1]);
+ BOOST_CHECK_EQUAL(seq[2], agct[2]);
+ BOOST_CHECK_EQUAL(seq[3], agct[3]);
+
+ std::string bdv("BDv");
+ Sequence seq_bdv(bdv);
+ BOOST_CHECK_EQUAL(seq_bdv.size(), bdv.size());
+ // default alphabet only allows AGCTUN
+ BOOST_CHECK_EQUAL(seq_bdv.get_sequence(), "NNN");
+}
+
+BOOST_AUTO_TEST_CASE( subseq_names )
+{
+ Sequence s1("AAGGCCTT", Sequence::reduced_dna_alphabet);
+ s1.set_species("species");
+ s1.set_fasta_header("a fasta header");
+ Sequence s2 = s1.subseq(2,2);
+ BOOST_CHECK_EQUAL(s2, "GG");
+ BOOST_CHECK_EQUAL(s2.get_species(), s1.get_species());
+ BOOST_CHECK_EQUAL(s2.get_fasta_header(), s1.get_fasta_header());
+}
+
+BOOST_AUTO_TEST_CASE( sequence_start_stop )
+{
+ Sequence s1;
+ BOOST_CHECK_EQUAL( s1.start(), 0 );
+ BOOST_CHECK_EQUAL( s1.stop(), 0 );
+
+ std::string seq_string("AAGGCCTT");
+ Sequence s2(seq_string, Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_EQUAL( s2.start(), 0 );
+ BOOST_CHECK_EQUAL( s2.stop(), seq_string.size() );
+
+ std::string s3seq_string = seq_string.substr(2,3);
+ Sequence s3 = s2.subseq(2,3);
+ BOOST_CHECK_EQUAL( s3.start(), 2);
+ BOOST_CHECK_EQUAL( s3.stop(), 2+3);
+ BOOST_CHECK_EQUAL( s3.size(), 3);
+ BOOST_CHECK_EQUAL( s3, s3seq_string);
+
+ std::string s4seq_string = s3seq_string.substr(1,1);
+ Sequence s4 = s3.subseq(1,1);
+ BOOST_CHECK_EQUAL( s4.start(), 1 );
+ BOOST_CHECK_EQUAL( s4.stop(), 1+1);
+ BOOST_CHECK_EQUAL( s4.size(), 1);
+ BOOST_CHECK_EQUAL( s4, s4seq_string);
}
//! Can we load data from a file
BOOST_AUTO_TEST_CASE( sequence_load )
{
- fs::path seq_path(fs::path(EXAMPLE_DIR)/ "seq" );
+ fs::path seq_path(fs::path(EXAMPLE_DIR, fs::native)/ "seq");
seq_path /= "human_mck_pro.fa";
Sequence s;
- s.load_fasta(seq_path);
+ s.load_fasta(seq_path, Sequence::reduced_dna_alphabet);
BOOST_CHECK_EQUAL(s.subseq(0, 5), "GGATC"); // first few chars of fasta file
- BOOST_CHECK_EQUAL(s.get_header(), "gi|180579|gb|M21487.1|HUMCKMM1 Human "
+ BOOST_CHECK_EQUAL(s.subseq(2, 3), "ATC");
+ BOOST_CHECK_EQUAL(s.get_fasta_header(), "gi|180579|gb|M21487.1|HUMCKMM1 Human "
"muscle creatine kinase gene (CKMM), "
"5' flank");
}
+BOOST_AUTO_TEST_CASE( sequence_load_fasta_error )
+{
+ fs::path seq_path(fs::path(EXAMPLE_DIR, fs::native)/"seq");
+ seq_path /= "broken.fa";
+ bool exception_thrown = false;
+ std::string exception_filename;
+ Sequence s;
+ try {
+ s.load_fasta(seq_path);
+ } catch(sequence_invalid_load_error e) {
+ exception_thrown = true;
+ size_t native_string_size = seq_path.native_file_string().size();
+ std:string estr(e.what());
+ BOOST_REQUIRE(estr.size() > native_string_size);
+ std::copy(estr.begin(), estr.begin()+native_string_size,
+ std::back_inserter(exception_filename));
+ }
+ BOOST_CHECK_EQUAL(exception_thrown, true);
+ BOOST_CHECK_EQUAL(seq_path.native_file_string(), exception_filename);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_load_annot_error )
+{
+ fs::path seq_path(fs::path(EXAMPLE_DIR, fs::native)/"seq");
+ seq_path /= "mouse_mck_pro.fa";
+ fs::path annot_path(fs::path(EXAMPLE_DIR, fs::native));
+ annot_path /= "broken.annot";
+ bool exception_thrown = false;
+ Sequence s;
+ s.load_fasta(seq_path);
+
+ std::string exception_filename;
+ try {
+ s.load_annot(annot_path, 0, 0);
+ } catch(annotation_load_error e) {
+ exception_thrown = true;
+ std:string estr(e.what());
+ size_t native_string_size = annot_path.native_file_string().size();
+ BOOST_REQUIRE(estr.size() > native_string_size);
+ std::copy(estr.begin(), estr.begin()+native_string_size,
+ std::back_inserter(exception_filename));
+ }
+ BOOST_CHECK_EQUAL(exception_thrown, true);
+ BOOST_CHECK_EQUAL(annot_path.native_file_string(), exception_filename);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_load_dna_reduced )
+{
+ std::string reduced_dna_fasta_string(">foo\nAAGGCCTTNN\n");
+ std::stringstream reduced_dna_fasta(reduced_dna_fasta_string);
+ std::string invalid_dna_fasta_string(">wrong\nAUSSI\n");
+ std::stringstream invalid_dna_fasta(invalid_dna_fasta_string);
+ std::string reduced_rna_fasta_string(">foo\nAAGGCCUUNN-\n");
+ std::stringstream reduced_rna_fasta(reduced_rna_fasta_string);
+ std::string garbage_string(">foo\na34ralk3547oilk,jual;(*&^#%-\n");
+ std::stringstream garbage_fasta(garbage_string);
+
+ Sequence s;
+ s.load_fasta(reduced_dna_fasta, Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_THROW(s.load_fasta(invalid_dna_fasta,
+ Sequence::reduced_dna_alphabet),
+ sequence_invalid_load_error);
+ BOOST_CHECK_THROW(s.load_fasta(reduced_rna_fasta,
+ Sequence::reduced_dna_alphabet),
+ sequence_invalid_load_error);
+ BOOST_CHECK_THROW(s.load_fasta(garbage_fasta,
+ Sequence::reduced_dna_alphabet),
+ sequence_invalid_load_error);
+
+}
+
+BOOST_AUTO_TEST_CASE( sequence_load_rna_reduced )
+{
+ std::string reduced_rna_fasta_string(">foo\nAAGGCCUUNN\n");
+ std::stringstream reduced_rna_fasta(reduced_rna_fasta_string);
+ std::string invalid_rna_fasta_string(">wrong\nATSSI\n");
+ std::stringstream invalid_rna_fasta(invalid_rna_fasta_string);
+ std::string reduced_dna_fasta_string(">foo\nAAGGCCTTNN\n");
+ std::stringstream reduced_dna_fasta(reduced_dna_fasta_string);
+ std::string garbage_string(">foo\na34ralk3547oilk,jual;(*&^#%-\n");
+ std::stringstream garbage_fasta(garbage_string);
+
+ Sequence s;
+ s.load_fasta(reduced_rna_fasta, Sequence::reduced_rna_alphabet);
+ BOOST_CHECK_THROW(s.load_fasta(invalid_rna_fasta,
+ Sequence::reduced_rna_alphabet),
+ sequence_invalid_load_error);
+ BOOST_CHECK_THROW(s.load_fasta(reduced_dna_fasta,
+ Sequence::reduced_rna_alphabet),
+ sequence_invalid_load_error);
+ BOOST_CHECK_THROW(s.load_fasta(garbage_fasta,
+ Sequence::reduced_rna_alphabet),
+ sequence_invalid_load_error);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_load_fasta_default )
+{
+ std::string reduced_rna_fasta_string(">foo\nAAGGCCUUNN\n");
+ std::stringstream reduced_rna_fasta1(reduced_rna_fasta_string);
+ std::stringstream reduced_rna_fasta2(reduced_rna_fasta_string);
+ std::string invalid_nucleotide_fasta_string(">wrong\nATSSI\n");
+ std::stringstream invalid_nucleotide_fasta(invalid_nucleotide_fasta_string);
+ std::string reduced_dna_fasta_string(">foo\nAAGGCCTTNN\n");
+ std::stringstream reduced_dna_fasta1(reduced_dna_fasta_string);
+ std::stringstream reduced_dna_fasta2(reduced_dna_fasta_string);
+ std::string garbage_string(">foo\na34ralk3547oilk,jual;(*&^#%-\n");
+ std::stringstream garbage_fasta(garbage_string);
+
+ Sequence s;
+ Sequence specific;
+ // there's two copies of reduced_rna_fasta because i didn't feel like
+ // figuring out how to properly reset the read pointer in a stringstream
+ s.load_fasta(reduced_rna_fasta1);
+ specific.load_fasta(reduced_rna_fasta2, Sequence::reduced_nucleic_alphabet);
+ BOOST_CHECK_EQUAL(s, specific);
+
+ s.load_fasta(reduced_dna_fasta1);
+ specific.load_fasta(reduced_dna_fasta2, Sequence::reduced_nucleic_alphabet);
+ BOOST_CHECK_EQUAL(s, specific);
+
+ BOOST_CHECK_THROW(s.load_fasta(invalid_nucleotide_fasta),
+ sequence_invalid_load_error);
+ BOOST_CHECK_THROW(s.load_fasta(garbage_fasta),
+ sequence_invalid_load_error);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_load_multiple_sequences_one_fasta )
+{
+ std::string fasta_file(
+ ">gi|10129974|gb|AF188002.1|AF188002\n"
+ "AAAAGGCTCCTGTCATATTGTGTCCTGCTCTGGTCTGC\n"
+ ">gi|180579|gb|M21487.1|HUMCKMM1\n"
+ "CGCCGAGAGCGCTTGCTCTGCCCAGATCTCGGCGAGTC\n"
+ ">gi|1621|emb|X55146.1|OCMCK1\n"
+ "CTCCCTGAGGGGAGTGCCCCGCTTAGCCC\n"
+ );
+ istringstream seq1_file(fasta_file);
+ Sequence seq1;
+ seq1.load_fasta(seq1_file, 1, 0, 0);
+ BOOST_CHECK_EQUAL(seq1.get_sequence(), "AAAAGGCTCCTGTCATATTGTGTCCTGCTCTGGTCTGC");
+
+ istringstream seq2_file(fasta_file);
+ Sequence seq2;
+ seq2.load_fasta(seq2_file, 2, 0, 0);
+ BOOST_CHECK_EQUAL(seq2.get_sequence(), "CGCCGAGAGCGCTTGCTCTGCCCAGATCTCGGCGAGTC");
+
+ istringstream seq3_file(fasta_file);
+ Sequence seq3;
+ seq3.load_fasta(seq3_file, 3, 0, 0);
+ BOOST_CHECK_EQUAL(seq3.get_sequence(), "CTCCCTGAGGGGAGTGCCCCGCTTAGCCC");
+}
+
+BOOST_AUTO_TEST_CASE( sequence_reverse_complement )
+{
+ std::string iupac_symbols("AaCcGgTtRrYySsWwKkMmBbDdHhVvNn-~.?");
+ Sequence seq(iupac_symbols, Sequence::nucleic_alphabet);
+ Sequence seqr = seq.rev_comp();
+
+ BOOST_CHECK( seq != seqr );
+ BOOST_CHECK_EQUAL( seq, seqr.rev_comp() );
+ // forcing sequence to upper case
+ BOOST_CHECK_EQUAL( seq.get_sequence(),
+ boost::algorithm::to_upper_copy(iupac_symbols) );
+}
+
+BOOST_AUTO_TEST_CASE( sequence_reverse_complement_dna )
+{
+ std::string dna_str("AGCTN");
+ Sequence dna_seq(dna_str, Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_EQUAL(dna_seq.rev_comp(), "NAGCT");
+ BOOST_CHECK_EQUAL(dna_seq, dna_seq.rev_comp().rev_comp());
+}
+
+BOOST_AUTO_TEST_CASE( sequence_reverse_complement_rna )
+{
+ std::string rna_str("AGCUN");
+ Sequence rna_seq(rna_str, Sequence::reduced_rna_alphabet);
+ BOOST_CHECK_EQUAL(rna_seq.rev_comp(), "NAGCU");
+ BOOST_CHECK_EQUAL(rna_seq, rna_seq.rev_comp().rev_comp());
+}
+
+BOOST_AUTO_TEST_CASE( sequence_reverse_complement_subseq )
+{
+ std::string dna_str("AAAAAAAAAAGGGGGGGGGGG");
+ Sequence seq(dna_str, Sequence::reduced_dna_alphabet);
+ Sequence subseq = seq.subseq(8,4);
+ BOOST_CHECK_EQUAL( subseq, "AAGG");
+ Sequence rev_subseq = subseq.rev_comp();
+ BOOST_CHECK_EQUAL( rev_subseq.size(), subseq.size() );
+ BOOST_CHECK_EQUAL( rev_subseq.get_sequence(), "CCTT");
+}
+
+BOOST_AUTO_TEST_CASE( sequence_reverse_iterator )
+{
+ std::string dna_str("AAAAAAAAAAGGGGGGGGGGG");
+ std::string dna_str_reversed(dna_str.rbegin(), dna_str.rend());
+ Sequence seq(dna_str);
+ std::string seq_reversed(seq.rbegin(), seq.rend());
+ BOOST_CHECK_EQUAL(seq_reversed, dna_str_reversed);
+
+ std::string substr = dna_str.substr(8,4);
+ Sequence subseq = seq.subseq(8,4);
+ BOOST_CHECK_EQUAL(substr, subseq);
+
+ std::string substr_reversed(substr.rbegin(), substr.rend());
+ std::string subseq_reversed(subseq.rbegin(), subseq.rend());
+ BOOST_CHECK_EQUAL(substr_reversed, subseq_reversed);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_empty_reverse_iterator)
+{
+ // so what happens with reverse interators when we have no sequence?
+ Sequence seq1;
+ Sequence seq2;
+ Sequence seq3("AGCT");
+
+ // all the empty sequences should have equal iterators
+ BOOST_CHECK(seq1.rbegin() == seq1.rend());
+ BOOST_CHECK(seq1.rbegin() == seq2.rend());
+
+ // none of the seq1 iterators should equal any of the seq3 iterators
+ BOOST_CHECK(seq1.rbegin() != seq3.rbegin());
+ BOOST_CHECK(seq1.rbegin() != seq3.rend());
+ BOOST_CHECK(seq1.rend() != seq3.rbegin());
+ BOOST_CHECK(seq1.rend() != seq3.rend());
+
+ // seq3 iterators should work
+ BOOST_CHECK(seq3.rbegin() != seq3.rend());
+
+}
+
BOOST_AUTO_TEST_CASE( annotation_load )
{
string annot_data = "human\n"
- "0 10 name\n" // type\n"
- "10 20 myf\n"
+ "0 10 name type\n"
+ "10 20 myf7\n"
"20 30 myod\n"
"50\t55 anothername\n"
"60 50 backward\n"
- ">ident\n"
- "GCT\n"
+ ">ident3 asdf\n"
"GCT\n"
+ "gCTn\n"
+ "75\t90\tname2\ttype2\n"
+ "100 120 name-asdf type!@#$%\n"
;
- string s('A',100);
- s += "GCTGCT";
- Sequence seq(s);
+ string s(100, 'A');
+ s += "GCTGCTAATT";
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
//istringstream annot_stream(annot_data);
seq.parse_annot(annot_data, 0, 0);
std::list<annot> annots_list = seq.annotations();
std::vector<annot> annots(annots_list.begin(), annots_list.end());
- BOOST_REQUIRE_EQUAL( annots.size(), 5);
- BOOST_CHECK_EQUAL( annots[0].start, 0 );
+ BOOST_REQUIRE_EQUAL( annots.size(), 8);
+ BOOST_CHECK_EQUAL( annots[0].begin, 0 );
BOOST_CHECK_EQUAL( annots[0].end, 10 );
- //BOOST_CHECK_EQUAL( annots[0].type, "type");
+ BOOST_CHECK_EQUAL( annots[0].type, "type");
BOOST_CHECK_EQUAL( annots[0].name, "name");
- //BOOST_CHECK_EQUAL( annots[1].name, "myf7");
+ BOOST_CHECK_EQUAL( annots[1].name, "myf7");
+ BOOST_CHECK_EQUAL( annots[2].name, "myod");
+ BOOST_CHECK_EQUAL( annots[3].name, "anothername");
+ BOOST_CHECK_EQUAL( annots[4].name, "backward");
+ BOOST_CHECK_EQUAL( annots[5].name, "name2");
+ BOOST_CHECK_EQUAL( annots[5].end, 90);
+ BOOST_CHECK_EQUAL( annots[6].begin, 100);
+ BOOST_CHECK_EQUAL( annots[6].end, 120);
+ BOOST_CHECK_EQUAL( annots[6].name, "name-asdf");
+ BOOST_CHECK_EQUAL( annots[6].type, "type!@#$%");
+ // sequence defined annotations will always be after the
+ // absolute positions
+ BOOST_CHECK_EQUAL( annots[7].name, "ident3 asdf");
+ BOOST_CHECK_EQUAL( annots[7].begin, 100);
//BOOST_CHECK_EQUAL( annots
}
+BOOST_AUTO_TEST_CASE( annotation_broken_load )
+{
+ string annot_data = "human\n"
+ "0 10 name type\n"
+ "blah60 50 backward\n"
+ ">ident3 asdf\n"
+ "GCT\n"
+ "gCTn\n"
+ ;
+ string s(100, 'A');
+ s += "GCTGCTAATT";
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
+
+ BOOST_CHECK_THROW(seq.parse_annot(annot_data, 0, 0), annotation_load_error);
+ BOOST_CHECK_EQUAL(seq.annotations().size(), 0);
+ }
+
+BOOST_AUTO_TEST_CASE(annotation_ucsc_html_load)
+{
+ // this actually is basically what's returned by UCSC
+ // (well actually with some of the sequence and copies of fasta blocks
+ // removed to make the example shorter
+ string annot_data = "\n"
+ "<PRE>\n"
+ ">hg17_knownGene_NM_001824_0 range=chr19:50517919-50517974 5'pad=0 3'pad=0 revComp=TRUE strand=- repeatMasking=none\n"
+ "GGGTCAGTGTCACCTCCAGGATACAGACAG\n"
+ ">hg17_knownGene_NM_001824_3 range=chr19:50510563-50510695 5'pad=0 3'pad=0 revComp=TRUE strand=- repeatMasking=none\n"
+ "GGTGGAGACGACCTGGACCCTAACTACGT\n"
+ "</PRE>\n"
+ "\n"
+ "</BODY>\n"
+ "</HTML>\n"
+ ;
+
+ string s =
+ "TGGGTCAGTGTCACCTCCAGGATACAGACAGCCCCCCTTCAGCCCAGCCCAGCCAG"
+ "AAAAA"
+ "GGTGGAGACGACCTGGACCCTAACTACGTGCTCAGCAGCCGCGTCCGCAC";
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
+ seq.parse_annot(annot_data);
+ std::list<annot> annots = seq.annotations();
+ BOOST_CHECK_EQUAL( annots.size(), 2);
+}
+
+BOOST_AUTO_TEST_CASE( annotation_load_no_species_name )
+{
+ string annot_data = "0 10 name type\n"
+ "10 20 myf7\n"
+ "20 30 myod\n"
+ "50\t55 anothername\n"
+ "60 50 backward\n"
+ ">ident3 asdf\n"
+ "GCT\n"
+ "gCTn\n"
+ "75\t90\tname2\ttype2\n"
+ "100 120 name-asdf type!@#$%\n"
+ ;
+ string s(100, 'A');
+ s += "GCTGCTAATT";
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
+
+ //istringstream annot_stream(annot_data);
+ seq.parse_annot(annot_data, 0, 0);
+ std::list<annot> annots_list = seq.annotations();
+ std::vector<annot> annots(annots_list.begin(), annots_list.end());
+ BOOST_REQUIRE_EQUAL( annots.size(), 8);
+ BOOST_CHECK_EQUAL( annots[0].begin, 0 );
+ BOOST_CHECK_EQUAL( annots[0].end, 10 );
+ BOOST_CHECK_EQUAL( annots[0].type, "type");
+}
+
// ticket:83 when you try to load a sequence from a file that doesn't
// have fasta headers it crashes.
BOOST_AUTO_TEST_CASE( sequence_past_end )
{
- fs::path seq_path(fs::path(EXAMPLE_DIR)/ "seq" );
+ fs::path seq_path(fs::path(EXAMPLE_DIR, fs::native)/ "seq" );
seq_path /= "misformated_seq.fa";
Sequence s;
BOOST_CHECK_THROW( s.load_fasta(seq_path), mussa_load_error );
BOOST_AUTO_TEST_CASE ( sequence_empty )
{
+
Sequence s;
BOOST_CHECK_EQUAL( s.empty(), true );
s = "AAAGGG";
BOOST_CHECK_EQUAL( s.empty(), false );
+ s.clear();
+ BOOST_CHECK_EQUAL( s.empty(), true);
+ s = "";
+ BOOST_CHECK_EQUAL( s.empty(), true);
}
+BOOST_AUTO_TEST_CASE ( sequence_size )
+{
+
+ Sequence s;
+ BOOST_CHECK_EQUAL( s.size(), 0);
+ std::string seq_string("AAAGGG");
+ s = seq_string;
+ BOOST_CHECK_EQUAL( s.size(), seq_string.size() );
+ s.clear();
+ BOOST_CHECK_EQUAL( s.size(), 0);
+ s = "";
+ BOOST_CHECK_EQUAL( s.size(), 0);
+}
+
+BOOST_AUTO_TEST_CASE( sequence_empty_equality )
+{
+ Sequence szero("", Sequence::reduced_dna_alphabet);
+ BOOST_CHECK_EQUAL(szero.empty(), true);
+ BOOST_CHECK_EQUAL(szero, szero);
+ BOOST_CHECK_EQUAL(szero, "");
+
+ Sequence sclear("AGCT", Sequence::reduced_dna_alphabet);
+ sclear.clear();
+ BOOST_CHECK_EQUAL(sclear.empty(), true);
+ BOOST_CHECK_EQUAL(sclear, sclear);
+ BOOST_CHECK_EQUAL(sclear, szero);
+ BOOST_CHECK_EQUAL(sclear, "");
+
+}
BOOST_AUTO_TEST_CASE ( sequence_iterators )
{
std::string seq_string = "AAGGCCTTNNTATA";
- Sequence s(seq_string);
+ Sequence s(seq_string, Sequence::reduced_dna_alphabet);
const Sequence cs(s);
std::string::size_type count = 0;
std::string::iterator str_itor;
- Sequence::iterator s_itor;
+ Sequence::const_iterator s_itor;
Sequence::const_iterator cs_itor;
for( str_itor = seq_string.begin(),
{
string m("AAAA");
string bogus("AATTGGAA");
- Sequence s1("AAAAGGGGCCCCTTTT");
+ Sequence s1("AAAAGGGGCCCCTTTT", Sequence::reduced_dna_alphabet);
list<motif>::const_iterator motif_i = s1.motifs().begin();
list<motif>::const_iterator motif_end = s1.motifs().end();
BOOST_CHECK( motif_end == s1.motifs().end() );
BOOST_CHECK( motif_i == motif_end );
-
+ // this shouldn't show up
s1.add_motif(bogus);
BOOST_CHECK( s1.motifs().begin() == s1.motifs().end() );
+ BOOST_CHECK_EQUAL( s1.motifs().size(), 0 );
+
s1.add_motif(m);
BOOST_CHECK( s1.motifs().begin() != s1.motifs().end() );
BOOST_CHECK_EQUAL( s1.motifs().size(), 2 );
s1.clear_motifs();
BOOST_CHECK( s1.motifs().begin() == s1.motifs().end() );
+
+ /* FIXME: enable this when i find a way of passing storing the motif name
+ // does our annotation travel?
+ Sequence motif_seq(m);
+ motif_seq.set_fasta_header("hi");
+ s1.add_motif(motif_seq);
+
+ BOOST_CHECK_EQUAL(s1.motifs().size(), 2);
+ for(motif_i = s1.motifs().begin();
+ motif_i != s1.motifs().end();
+ ++motif_i)
+ {
+ BOOST_CHECK_EQUAL( motif_i->type, "motif" );
+ BOOST_CHECK_EQUAL( motif_i->name, "hi");
+ BOOST_CHECK_EQUAL( motif_i->sequence, m);
+ }
+ */
+}
+
+BOOST_AUTO_TEST_CASE( sequence_motif_subseq)
+{
+ // when searching for a motif on a subsequence we should
+ // only search the subsequence ticket:199
+ string aaaa("AAAA");
+ string cccc("CCCC");
+ Sequence s1("AAAANCCCC", Sequence::reduced_dna_alphabet);
+
+ // this shouldn't show up
+ s1.add_motif(cccc);
+ BOOST_CHECK_EQUAL( s1.motifs().size(), 1 );
+
+ s1.add_motif(aaaa);
+ BOOST_CHECK_EQUAL( s1.motifs().size(), 2 );
+
+ Sequence subseq1 = s1.subseq(4,5);
+ BOOST_CHECK_EQUAL(subseq1.motifs().size(), 2);
+ subseq1.clear_motifs();
+ BOOST_CHECK_EQUAL(subseq1.motifs().size(), 0);
+ // this is outside of our subsequence, and so shouldn't be found
+ subseq1.add_motif(aaaa);
+ BOOST_CHECK_EQUAL( subseq1.motifs().size(), 0 );
+
+ subseq1.add_motif(cccc);
+ BOOST_CHECK_EQUAL( subseq1.motifs().size(), 1);
+ std::list<motif>::const_iterator motif_i = subseq1.motifs().begin();
+ BOOST_REQUIRE(motif_i != subseq1.motifs().end());
+ BOOST_CHECK_EQUAL(motif_i->begin, 1);
+ BOOST_CHECK_EQUAL(motif_i->end, 5);
}
BOOST_AUTO_TEST_CASE( annot_test )
{
annot a(0, 10, "test", "thing");
- BOOST_CHECK_EQUAL( a.start, 0 );
+ BOOST_CHECK_EQUAL( a.begin, 0 );
BOOST_CHECK_EQUAL( a.end, 10 );
BOOST_CHECK_EQUAL( a.type, "test" );
BOOST_CHECK_EQUAL( a.name, "thing" );
motif m(10, "AAGGCC");
- BOOST_CHECK_EQUAL( m.start, 10 );
+ BOOST_CHECK_EQUAL( m.begin, 10 );
BOOST_CHECK_EQUAL( m.type, "motif" );
BOOST_CHECK_EQUAL( m.name, "AAGGCC" );
BOOST_CHECK_EQUAL( m.end, 10+6 );
"AGCTAAAACTTTGGAAACTTTAGATCCCAGACAGGTGGCTTTCTTGCAGT");
string gc("GCCCCC");
string gga("GGACACCTC");
- Sequence seq(s);
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
std::list<Sequence> query_list;
std::list<string> string_list;
}
}
BOOST_CHECK_EQUAL(seq.annotations().size(), count);
+ const std::list<annot> &a = seq.annotations();
+ for (std::list<annot>::const_iterator annot_i = a.begin();
+ annot_i != a.end();
+ ++annot_i)
+ {
+ int count = annot_i->end - annot_i->begin ;
+ }
}
+BOOST_AUTO_TEST_CASE( subseq_annotation_test )
+{
+ string s("CCGCCCCCCATCATCGCGGCTCTCCGAGAGTCCCGCGCCCCACTCCCGGC"
+ "ACCCACCTGACCGCGGGCGGCTCCGGCCCCGCTTCGCCCCACTGCGATCA"
+ "GTCGCGTCCCGCAGGCCAGGCACGCCCCGCCGCTCCCGCTGCGCCGGGCG"
+ "TCTGGGACCTCGGGCGGCTCCTCCGAGGGGCGGGGCAGCCGGGAGCCACG"
+ "CCCCCGCAGGTGAGCCGGCCACGCCCACCGCCCGTGGGAAGTTCAGCCTC"
+ "GGGGCTCCAGCCCCGCGGGAATGGCAGAACTTCGCACGCGGAACTGGTAA"
+ "CCTCCAGGACACCTCGAATCAGGGTGATTGTAGCGCAGGGGCCTTGGCCA"
+ "AGCTAAAACTTTGGAAACTTTAGATCCCAGACAGGTGGCTTTCTTGCAGT");
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
+
+
+ seq.add_annotation(annot(0, 10, "0-10", "0-10"));
+ seq.add_annotation(annot(10, 20, "10-20", "10-20"));
+ seq.add_annotation(annot(0, 20, "0-20", "0-20"));
+ seq.add_annotation(annot(8, 12, "8-12", "8-12"));
+ seq.add_annotation(annot(100, 5000, "100-5000", "100-5000"));
+
+ Sequence subseq = seq.subseq(5, 10);
+ const list<annot> annots = subseq.annotations();
+ // generate some ground truth
+ list<annot> correct;
+ correct.push_back(annot(0, 5, "0-10", "0-10"));
+ correct.push_back(annot(5,10, "10-20", "10-20"));
+ correct.push_back(annot(0,10, "0-20", "0-20"));
+ correct.push_back(annot(3, 7, "8-12", "8-12"));
+ BOOST_REQUIRE_EQUAL( annots.size(), correct.size() );
+
+ list<annot>::iterator correct_i = correct.begin();
+ list<annot>::const_iterator annot_i = annots.begin();
+ for(; annot_i != annots.end(); ++annot_i, ++correct_i)
+ {
+ BOOST_CHECK( *annot_i == *correct_i );
+ }
+}
+
+BOOST_AUTO_TEST_CASE( motif_annotation_update )
+{
+ string s("CCGTCCCCCATCATCGCGGCTCTCCGAGAGTCCCGCGCCCCACTCCCGGC"
+ "ACCCACCTGACCGCGGGCGGCTCCGGCCCCGCTTCGCCCCACTGCGATCA"
+ "GTCGCGTCCCGCAGGCCAGGCACGCCCCGCCGCTCCCGCTGCGCCGGGCG"
+ "TCTGGGACCTCGGGCGGCTCCTCCGAGGGGCGGGGCAGCCGGGAGCCACG"
+ "CCCCCGCAGGTGAGCCGGCCACGCCCACCGCCCGTGGGAAGTTCAGCCTC"
+ "GGGGCTCCAGCCCCGCGGGAATGGCAGAACTTCGCACGCGGAACTGGTAA"
+ "CCTCCAGGACACCTCGAATCAGGGTGATTGTAGCGCAGGGGCCTTGGCCA"
+ "AGCTAAAACTTTGGAAACTTTAGATCCCAGACAGGTGGCTTTCTTGCAGT");
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
+
+ // starting conditions
+ BOOST_CHECK_EQUAL(seq.annotations().size(), 0);
+ BOOST_CHECK_EQUAL(seq.motifs().size(), 0);
+ seq.add_annotation(annot(0, 10, "0-10", "0-10"));
+ seq.add_annotation(annot(10, 20, "10-20", "10-20"));
+ seq.add_annotation(annot(0, 20, "0-20", "0-20"));
+ BOOST_CHECK_EQUAL(seq.annotations().size(), 3);
+ BOOST_CHECK_EQUAL(seq.motifs().size(), 0);
+ seq.add_motif("CCGTCCC");
+ BOOST_CHECK_EQUAL(seq.annotations().size(), 3);
+ BOOST_CHECK_EQUAL(seq.motifs().size(), 1);
+ seq.clear_motifs();
+ BOOST_CHECK_EQUAL(seq.annotations().size(), 3);
+ BOOST_CHECK_EQUAL(seq.motifs().size(), 0);
+}
+
+BOOST_AUTO_TEST_CASE( out_operator )
+{
+ string s("AAGGCCTT");
+ Sequence seq(s, Sequence::reduced_dna_alphabet);
+
+ ostringstream buf;
+ buf << s;
+ BOOST_CHECK_EQUAL( s, buf.str() );
+}
+
+BOOST_AUTO_TEST_CASE( get_name )
+{
+ Sequence seq("AAGGCCTT", Sequence::reduced_dna_alphabet);
+
+ BOOST_CHECK_EQUAL( seq.get_name(), "" );
+ seq.set_species("hooman"); // anyone remember tradewars?
+ BOOST_CHECK_EQUAL( seq.get_name(), "hooman");
+ seq.set_fasta_header("fasta human");
+ BOOST_CHECK_EQUAL( seq.get_name(), "fasta human");
+}
+
+BOOST_AUTO_TEST_CASE( serialize_simple )
+{
+ std::string seq_string = "AAGGCCTT";
+ Sequence seq(seq_string, Sequence::reduced_dna_alphabet);
+ seq.set_species("ribbet");
+ std::ostringstream oss;
+ // allocate/deallocate serialization components
+ {
+ boost::archive::text_oarchive oarchive(oss);
+ const Sequence& const_seq(seq);
+ BOOST_CHECK_EQUAL(seq, const_seq);
+ oarchive << const_seq;
+ }
+ Sequence seq_loaded;
+ {
+ std::istringstream iss(oss.str());
+ boost::archive::text_iarchive iarchive(iss);
+ iarchive >> seq_loaded;
+ }
+ BOOST_CHECK_EQUAL(seq_loaded, seq);
+ BOOST_CHECK_EQUAL(seq.get_species(), "ribbet");
+}
+
+BOOST_AUTO_TEST_CASE( serialize_tree )
+{
+ std::string seq_string = "AAGGCCTT";
+ Sequence seq(seq_string, Sequence::reduced_dna_alphabet);
+ seq.set_species("ribbet");
+ seq.add_motif("AA");
+ seq.add_motif("GC");
+ annot a1(6,7,"t","t");
+ seq.add_annotation(a1);
+
+ std::ostringstream oss;
+ // allocate/deallocate serialization components
+ {
+ boost::archive::text_oarchive oarchive(oss);
+ const Sequence& const_seq(seq);
+ BOOST_CHECK_EQUAL(seq, const_seq);
+ oarchive << const_seq;
+ }
+
+ Sequence seq_loaded;
+ {
+ std::istringstream iss(oss.str());
+ boost::archive::text_iarchive iarchive(iss);
+ iarchive >> seq_loaded;
+ }
+ BOOST_CHECK_EQUAL(seq_loaded, seq);
+}
+
+// this writes out an "old" style annotated sequence
+// with annotations attached as "motifs" and "annots"
+BOOST_AUTO_TEST_CASE( serialize_xml_sequence )
+{
+ std::string seq_string = "AAGGCCTT";
+ Sequence seq(seq_string, Sequence::reduced_dna_alphabet);
+ seq.set_species("ribbet");
+ seq.add_motif("AA");
+ seq.add_motif("GC");
+ annot a1(6,7,"t","t");
+ seq.add_annotation(a1);
+
+ std::ostringstream oss;
+ // allocate/deallocate serialization components
+ {
+ boost::archive::xml_oarchive oarchive(oss);
+ const Sequence& const_seq(seq);
+ BOOST_CHECK_EQUAL(seq, const_seq);
+ oarchive << boost::serialization::make_nvp("root", const_seq);
+ }
+ Sequence seq_loaded;
+ {
+ std::istringstream iss(oss.str());
+ boost::archive::xml_iarchive iarchive(iss);
+ iarchive >> boost::serialization::make_nvp("root", seq_loaded);
+ }
+ BOOST_CHECK_EQUAL(seq_loaded, seq);
+}
+
+BOOST_AUTO_TEST_CASE( serialize_xml_two )
+{
+ std::string seq_string = "AAGGCCTT";
+ Sequence seq1(seq_string, Sequence::reduced_dna_alphabet);
+ Sequence seq2(seq1);
+
+ std::ostringstream oss;
+ // allocate/deallocate serialization components
+ {
+ boost::archive::xml_oarchive oarchive(oss);
+ const Sequence& const_seq1(seq1);
+ const Sequence& const_seq2(seq2);
+ oarchive << boost::serialization::make_nvp("seq1", const_seq1);
+ oarchive << boost::serialization::make_nvp("seq2", const_seq2);
+ }
+ //std::cout << "xml: " << oss.str() << std::endl;
+ Sequence seq1_loaded;
+ Sequence seq2_loaded;
+ {
+ std::istringstream iss(oss.str());
+ boost::archive::xml_iarchive iarchive(iss);
+ iarchive >> boost::serialization::make_nvp("seq1", seq1_loaded);
+ iarchive >> boost::serialization::make_nvp("seq2", seq2_loaded);
+ }
+ BOOST_CHECK_EQUAL(seq1_loaded, seq1);
+ BOOST_CHECK_EQUAL(seq2_loaded, seq2);
+ // test if our pointers are the same
+ BOOST_CHECK_EQUAL(seq1_loaded.data(), seq2_loaded.data());
+}