Brandon W. King
---------------
-Last updated: May 23th, 2006
+Last updated: Oct 17th, 2006
+
+Updated to Mussagl build: (In process to 424)
+
+
+.. Things to add
+ * New features / change log
+ * Comment out anything isn't implemented yet.
+ * (DONE) List of features that will be implemented in the future.
+ * Look into the homology mapping of UCSC.
+ * Add toggle to genomes.
+ * Document why one fast record per region.
+ * How to deal with the hazards of small utrs vis motif finder. (Add warning)
+ * Add warning about saving FASTA file.
+ * Add a general principles section near the top
+ * Using comparison algorithm which will pickup all repeats
+ * Add info about repeatmasking
+ * Checking upstream and downstream genes for make sure you are in the right regions.
+ * Later on: look into Ensembl
+ * Look into method of homology instead of blating.
+ * Mention advantages of using mupa.
+ * Mention the difference between using arrows and scroll bar
+ * Document the color for motifs
+ * Update for Mac user left-click
+
+ * Wormbase/Flybase/mirBASE tutorials
-Updated to Mussagl build: 141 (Update to 200 in progress)
.. contents::
+Status
+======
+
+Major New Features
+------------------
+
+ * Build 381
+ * Analysis "Save As" feature
+
+Change Log
+----------
+
+.. INSERT CHANGE LOG HERE
+.. END INSERT CHANGE LOG
+
+Features to be Implemented
+--------------------------
+
+ * Motif editor supporting more than 10 motifs
+ (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/122)
+ * Save motifs from Mussagl
+ (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/133)
+
+For an up-to-date list of features to be implemented visit:
+http://woldlab.caltech.edu/cgi-bin/mussa/roadmap
+
Introduction
============
What is Mussagl?
----------------
+Mussa is an N-way version of the FamilyRelations (which is a part of
+the Cartwheel project) 2-way comparative sequence analysis
+software. Given DNA sequence from N species, Mussa uses all possible
+pairwise comparions to derive an N-wise comparison. For example, given
+sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
+1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
+these comparisons, saving those that satisfy a transitivity
+requirement. The saved paths are then displayed in an interactive
+viewer.
Short History of Mussa
----------------------
-
Mussa Python/PMW Prototype
~~~~~~~~~~~~~~~~~~~~~~~~~~
+First Python/PMW based protoype.
Mussa C++/FLTK
~~~~~~~~~~~~~~
+A rewrite for speed purposes using C++ and FLTK GUI toolkit.
Mussagl C++/Qt/OpenGL
~~~~~~~~~~~~~~~~~~~~~
+Refactored version using the more elegant Qt GUI framework and
+OpenGL for hardware acceleration for those who have better graphics
+cards.
Getting Mussagl
===============
__ wiki_
+Obtaining Input Data
+====================
+
+If you already have your data, you can skip ahead to the the `Using
+Mussagl`_ section.
+
+Let's say you have a gene of interest called 'SMN1' and you want to
+know how the sequence surrounding the gene in multiple species is
+conserved. Guess what, that's what we are going to do, retrieve the
+DNA sequence for SMN1 and prepare it for using in Mussa.
+
+For more information about SMN1 visit `NCBI's OMIM
+<http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
+
+The SMN1 data retrieved in this section can be downloaded from the
+`Mussa Example Data
+<http://woldlab.caltech.edu/cgi-bin/mussa/wiki/ExampleData>`_ page if
+you prefer to skip this section of the manual.
+
+
+UCSC Genome Browser Method
+--------------------------
+
+There are many methods of retrieving DNA sequence, but for this
+example we will retrieve SMN1 through the UCSC genome browser located
+at http://genome.ucsc.edu/.
+
+
+.. image:: images/ucsc_genome_browser_home.png
+ :alt: UCSC Genome Browser
+ :align: center
+
+Step 1 - Find SMN1
+~~~~~~~~~~~~~~~~~~
+
+The first step in finding SMN1 is to use the **Gene Sorter** menu
+option which I have highlighted in orange below:
+
+.. image:: images/ucsc_menu_bar_gene_sorter.png
+ :alt: Gene Sorter Menu Option
+ :align: center
+
+Gene Sorter page:
+
+.. image:: images/ucsc_gene_sorter.png
+ :alt: Gene Sorter
+ :align: center
+
+We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
+
+.. image:: images/ucsc_gs_sort_name_sim.png
+ :alt: Gene Sorter - Name Similarity
+ :align: center
+
+After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
+
+.. image:: images/ucsc_gs_smn1.png
+ :alt: Gene
+ :align: center
+
+Press **Go!** and you should see the following page:
+
+.. image:: images/ucsc_gs_found.png
+ :alt: Found SMN1
+ :align: center
+
+Click on **SMN1** and you will be taking the gene expression atlas
+page.
+
+.. image:: images/ucsc_gs_genome_position.png
+ :alt: Gene expression atlas
+ :align: center
+
+Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
+position column**.
+
+Now we have found the location of SMN1 on human!
+
+.. image:: images/ucsc_gb_smn1_human.png
+ :alt: Genome Browser - SMN1 (human)
+ :align: center
+
+
+Step 2 - Download CDS/UTR sequence for annotations
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+Since we have found **SMN1**, this would be a convenient time to extract
+the DNA sequence for the CDS and UTRs of the gene to use it as an
+annotation_ in Mussa.
+
+**Click on SMN1** shown **between** the **two orange arrows** shown
+below.
+
+.. image:: images/ucsc_gb_smn1_human_click_smn1.png
+ :alt: Genome Browser - SMN1 (human) - Orange Arrows
+ :align: center
+
+You should find yourself at the SMN1 description page.
+
+.. image:: images/ucsc_gb_smn1_description_page.png
+ :alt: Genome Browser - SMN1 (human) - Description page
+ :align: center
+
+**Scroll down** until you get to the **Sequence section** and click on
+**Genomic (chr5:70,256,524-70,284,592)**.
+
+.. image:: images/ucsc_gb_smn1_human_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Sequence
+ :align: center
+
+You should now be at the **Genomic sequence near gene** page:
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Get genomic sequence
+ :align: center
+
+Make the following changes (highlighted in orange in the screenshot
+below):
+
+ 1. UNcheck **introns**.
+ (We only want to annotate CDS and UTRs.)
+ 2. Select **one FASTA record** per **region**.
+ (Mussa needs each CDS and UTR represented by one FASTA record per CDS/UTR).
+ 3. Select **CDS in upper case, UTR in lower case.**
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
+ :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
+ :align: center
+
+Now click the **submit** button. You will then see a FASTA file with
+many FASTA records representing the CDS and UTRS.
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
+ :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
+ :align: center
+
+Now you need to save the FASTA records to a **text file**. If you are
+using **Firefox** or **Internet Explorer 6+** click on the **File >
+Save As** menu option.
+
+**IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
+repeat **NOT Webpage Complete** (see screenshot below.)
+
+Type in **smn1_human_annot.txt** for the file name.
+
+.. image:: images/smn1_human_annot.png
+ :alt: Genome Browser - SMN1 (human) - sequence annotation file
+ :align: center
+
+**IMPORTANT:** You should open the file with a text editor and make
+ sure **no HTML** was saved... If you find any HTML markup, delete
+ the markup and save the file.
+
+Now we are going to **modify the file** you just saved to **add the
+name of the species** to the **annotation file**. All you have to do
+is **add a new line** at the **top of the file** with the word **'Human'** as
+shown below:
+
+.. image:: images/smn1_human_annot_plus_human.png
+ :alt: Genome Browser - SMN1 (human) - sequence annotation file
+ :align: center
+
+You can add more annotations to this file if you wish. See the
+`annotation file format`_ section for details of the file format. By
+including FASTA records in the annotation_ file, Mussa searches your
+DNA sequence for an exact match of the sequence in the annotation_
+file. If found, it will be marked as an annotation_ within Mussa.
+
+
+Step 3 - Download gene and upstream/downstream sequence
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+Use the back button in your web browser to get back the **genome
+browser view** of **SMN1** as shown below.
+
+.. image:: images/ucsc_gb_smn1_human.png
+ :alt: Genome Browser - SMN1 (human)
+ :align: center
+
+There are two options for getting additional sequence around your
+gene. The more complex way is to zoom out so that you have the
+sequence you want being shown in the genome browser and then follow
+the directions for the following method.
+
+The second option, which we will choose, is to leave the genome
+browser zoomed exactly at the location of SMN1 and click on the
+**DNA** option on the menu bar (shown with orange arrows in the
+screenshot below.)
+
+.. image:: images/ucsc_gb_smn1_human_dna_option.png
+ :alt: Genome Browser - SMN1 (human) - DNA Option
+ :align: center
+
+Now in the **get dna in window** page, let's add an arbitrary amount of
+extra sequence on to each end of the gene, let's say 5000 base pairs.
+
+.. image:: images/ucsc_gb_smn1_human_get_dna.png
+ :alt: Genome Browser - SMN1 (human) - Get DNA
+ :align: center
+
+Click the **get DNA** button.
+
+.. image:: images/ucsc_gb_smn1_human_dna.png
+ :alt: Genome Browser - SMN1 (human) - DNA
+ :align: center
+
+Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
+did in step 2 with the annotation file.
+
+**IMPORTANT:** Make sure the file is saved as a text file and not an
+HTML file. Open the file with a text editor and remove any HTML markup
+you find.
+
+
+Step 4 - Same/similar/related gene other species.
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+What good is a multiple sequence alignment viewer without multiple
+sequences? Let'S find a similar gene in a few more species.
+
+Use the back button on your web browser until you get the **genome
+browser view** of **SMN1** as shown below.
+
+.. image:: images/ucsc_genome_browser_home.png
+ :alt: UCSC Genome Browser
+ :align: center
+
+**Click on SMN1** shown **between** the **two orange arrows** shown
+below.
+
+.. image:: images/ucsc_gb_smn1_human_click_smn1.png
+ :alt: Genome Browser - SMN1 (human) - Orange Arrows
+ :align: center
+
+You should find yourself at the SMN1 description page.
+
+.. image:: images/ucsc_gb_smn1_description_page.png
+ :alt: Genome Browser - SMN1 (human) - Description page
+ :align: center
+
+**Scroll down** until you get to the **Sequence section** and click on
+**Protein (262 aa)**.
+
+.. image:: images/ucsc_gb_smn1_human_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Sequence
+ :align: center
+
+Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
+> Copy** option from the menu.
+
+.. image:: images/smn1_human_protein.png
+ :alt: Genome Browser - SMN1 (human) - Protein
+ :align: center
+
+Press the back button on the web browser once and then scroll to the
+top of the page and click on the **BLAT** option on the menu bar
+(shown below with orange arrows).
+
+.. image:: images/ucsc_gb_smn1_human_blat.png
+ :alt: Genome Browser - SMN1 (human) - Blat
+ :align: center
+
+**Paste** in the **protein sequence** and **change** the **genome** to
+**mouse** as shown below and then click **submit**.
+
+.. image:: images/ucsc_gb_smn1_human_blat_paste.png
+ :alt: Genome Browser - SMN1 (human) - Blat paste protein
+ :align: center
+
+Notice that we have two hits, one of which looks pretty good at 89.9%
+match.
+
+.. image:: images/ucsc_gb_smn1_human_blat_hits.png
+ :alt: Genome Browser - SMN1 (human) - Blat hits
+ :align: center
+
+**Click** on the **brower** link next to the 89.9% match. Notice in
+the genome browser (shown below) that there is an annotated gene
+called SMN1 for mouse which matches the line called **your sequence
+from blat search**. This means we are fairly confidant we found the
+right location in the mouse genome.
+
+.. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
+ :alt: Genome Browser - SMN1 (human) - Blat to browser
+ :align: center
+
+Follow steps 1 through 3 for mouse and then repeat step 4 with the
+human protein sequence to find **SMN1** in the following species (if
+you find a match):
+
+ 1. Rat
+ 2. Rabbit
+ 3. Dog
+ 4. Armadillo
+ 5. Elephant
+ 6. Opposum
+ 7. x_tropicalis
+
+Make sure to save the extended DNA sequence and annotation file for
+each one.
+
Using Mussagl
=============
'demo_w30_t20'. Mussa will create a folder with this name to store
the analysis files in once it has been run.
- 2. Choose a `window size`_. For this demo **choose 30**.
-
- 3. Choose a threshold_... for this demo **choose 20**. See the
+ 2. Choose a threshold_... for this demo **choose 20**. See the
Threshold_ section for more detailed information.
+ 3. Choose a `window size`_. For this demo **choose 30**.
+
+
4. Choose the number of sequences_ you would like. For this demo
**choose 3**.
:alt: Steps 1-4
:align: center
-Now click on the 'Browse' button next to the sequence input box and
-then select /examples/seq/human_mck_pro.fa file. Do the same in the
-next two sequence input boxes selecting mouse_mck_pro.fa and
-rabbit_mck_pro.fa as shown below. Note that you can create annotation
-files using the mussa `Annotation File Format`_ to add annotations to
-your sequence.
+First enter the species name of "Human" in the first "Species" text
+box. Now click on the 'Browse' button next to the sequence input box
+and then select /examples/seq/human_mck_pro.fa file. Do the same in
+the next two sequence input boxes selecting mouse_mck_pro.fa and
+rabbit_mck_pro.fa as shown below. Make sure to give them a species
+name as well. Note that you can create annotation files using the
+mussa `Annotation File Format`_ to add annotations to your sequence.
.. image:: images/define_analysis_step2.png
:alt: Choose sequences
:alt: Mussagl Demo
:align: center
-This analysis is now saved in a directory called **demo_w30_t20** in
-the current working directory. If you close and reopen Mussagl, you
-can reload the saved analysis. See `Load an analysis`_ section below
-for details.
+By default your analysis is NOT saved. If you try to close an analysis
+without saving, you will be prompted with a dialog box asking you if
+you would like to save your analysis. The `Saving`_ section for
+details on saving your analysis. When saving, choose directory and
+give the analysis the name **demo_w30_t20**. If you close and reopen
+Mussagl, you will then be able to load the saved analysis. See `Load
+an analysis`_ section below for details.
Load a mussa parameter file
on creating a .mupa file.
Once you have a .mupa file created, load Mussagl and select the **File >
-Load Mussa Parameters** menu option. Select the .mupa file and click
+Create Analysis from File** menu option. Select the .mupa file and click
open.
.. image:: images/load_mupa_menu.png
~~~~~~~~~~~~~~~~
To load a previously run analysis open Mussagl and select the **File >
-Load Analysis** menu option. Select an analysis **directory** and
+Open Existing Analysis** menu option. Select an analysis **directory** and
click open.
.. image:: images/load_analysis_menu.png
3. Motif_
- 4. `Conservation tracks`_
+ 4. `Red conservation tracks`_
- 5. `Motif Toggle`_
+ 5. `Blue conservation tracks`_
6. `Zoom Factor`_ (Base pairs per pixel)
Each of the black bars represents one of the loaded sequences, in this
case the sequence around the gene 'MCK' in human, mouse, and rabbit.
-FIXME: Should I mention the repeats here?
-
Annotation
~~~~~~~~~~
Annotations can be included on any of the sequences using the `Load a
-mussa parameter file`_ method of loading your sequences. You can
-define annotations by location or using an exact sub-sequence and you
-may also choose any color for display of the annotation; see the
-`Annotation File Format`_ section for details.
-
-Note: Currently there is no way to add annotations using the GUI (only
-via the .mupa file). We plan to add this feature in the future, but it
-likely will not make it into the first release.
+mussa parameter file`_ or `Create a new analysis`_ method of loading
+your sequences. You can define annotations by location or using an
+exact sub-sequence or a FASTA sequence of the section of DNA you wish
+to annotate. See the `Annotation File Format`_ section for details.
Motif
Motif shown in light blue on sequence bar.
The only real difference between an annotation and motif in Mussagl is
-that you can define motifs from within the GUI. See the `Motifs`_
-section for more information.
+that you can define motifs and choose a color from within the GUI. See
+the `Motifs`_ section for more information.
-Conservation tracks
-~~~~~~~~~~~~~~~~~~~
+Red conservation tracks
+~~~~~~~~~~~~~~~~~~~~~~~
.. figure:: images/conservation_tracks.png
:alt: Conservation Tracks
bars.
The **red lines** between the sequence bars represent conservation
-between the sequences and **blue lines** represent **reverse
-complement** conservation. The amount of sequence conservation shown
-will depend on the relatedness of your sequences and the `dynamic
-threshold` you are using. Sequences with lots of repeats will cause
-major slow downs in calculating the matches.
+between the sequences (i.e. not reverse complement matches)
+
+The amount of sequence conservation shown will depend on how much your
+sequences are related and the `dynamic threshold`_ you are using.
-Motif Toggle
-~~~~~~~~~~~~
+Blue conservation tracks
+~~~~~~~~~~~~~~~~~~~~~~~~
-.. image:: images/motif_toggle.png
- :alt: Motif Toggle
+.. figure:: images/conservation_tracks.png
+ :alt: Conservation Tracks
:align: center
+
+ Conservations tracks shown as red and blue lines between sequence
+ bars.
-Toggles motifs on and off. This will not turn on and off annotations.
+**Blue lines** represent **reverse complement** conservation relative
+to the sequence attached to the top of the blue line.
-Note: As of the current build (#200), this feature hasn't been
-implemented.
+The amount of sequence conservation shown will depend on how much your
+sequences are related and the `dynamic threshold`_ you are using.
Zoom Factor
:alt: Dynamic Threshold
:align: center
-You can dynamically change the threshold for how strong of match you
-consider the conservation to be with one of two options:
+You can dynamically change the threshold for how strong a match you
+consider the conservation to be by changing the value in the dynamic
+threshold box.
- 1. Number of base pair matches out of window size.
-
- 2. Percent base pair conservation.
+The value you enter is the minimum number of base pairs that have to
+be matched in order to be considered conserved. The second number that
+you can't change is the `window size`_ you used when creating the
+experiment. The last number is the percent match.
See the Threshold_ section for more information.
2. Total Size of Sequence
3. Current base pair position
+Note that you can **update the species** text box. Make sure to **save your
+experiment** after making this change by selecting **File > Save
+Analysis** from the menu.
Sequence Scroll Bar
~~~~~~~~~~~~~~~~~~~
useful when you have zoomed in using the `zoom factor`_.
+Saving
+------
+
+Save on Close
+~~~~~~~~~~~~~
+
+FIXME: Write this.
+
+Save Analysis
+~~~~~~~~~~~~~
+
+After making changes, such as updating species names or adding/editing
+motifs, you can save these changes by selecting the **File > Save
+analysis** menu option or pressing **CTRL + S** (PC) or
+**Apple/Command Key + S** (on Mac).
+
+.. image:: images/save_analysis.png
+ :alt: Save analysis
+ :align: center
+
+Save Analysis As
+~~~~~~~~~~~~~~~~
+
+To save a copy of your analysis to a new location, select the **File >
+Save analysis as** menu option and choose a new location and name for
+your analysis.
+
+.. image:: images/save_analysis_as.png
+ :alt: Save analysis
+ :align: center
+
+Save Motif List
+~~~~~~~~~~~~~~~
+
+See `Save Motifs to File`_ in the `Motifs`_ section.
+
+
Annotations / Motifs
--------------------
previous run or by defining your own motif file. See the `Motif File
Format`_ section for details.
+NOTE: Valid motif list file extensions are:
+
+ * .mtl
+ * .txt
+
To load a motif file, select **Load Motif List** item from the
**File** menu and select a motif list file.
Save Motifs to File
*******************
-Note: Currently not implemented
+Motifs from the `Motif Dialog`_ can be saved to file for use with
+other analyses. If you just want your motifs to be saved with your
+analysis, see the `save analysis`_ section for details.
+
+To save a motif list, select **File > Save Motifs** menu option.
+
+.. image:: images/save_motifs.png
+ :alt: Save Motifs
+ :align: center
Motif Dialog
************
Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
-Code`_ for defining a motif. To define a motif, select **View > Edit
+Code`_ for defining a motif. To define a motif, select **Edit > Edit
Motifs** menu item as shown below.
.. image:: images/view_edit_motifs.png
:alt: "View > Edit Motifs" Menu
:align: center
-You will see a dialog box appear with a "set motifs" button and 10
-rows for defining motifs and the color that will be displayed on the
-sequence. By default all 10 motifs start off as with white as the
-color. In the image below, I changed the color from white to blue to
-make it easier to see.
+You will see a dialog box appear with a "apply" button in the bottom
+right and one rows for defining motifs and the color that will be
+displayed on the sequence. When you start adding your first motif, an
+additional row will be added. The check box in the first column
+defines whether the motif is displayed or not. The second column is
+the motif display color. The third column is for the name of your
+motif and finally, the fourth column is motif itself.
.. image:: images/motif_dialog_start.png
:alt: Motif Dialog
:align: center
-Now lets make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
-Code`_, type in **'ATSCT'** into the first box as shown below.
+Now let's make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
+Code`_, type in **'ATSCT'** into the motif field and **'My Motif'** for
+the name in the name field as shown below.
+
+Notice how a second row appeared when you started to add the first
+motif. Every time you add a new motif, a new row will appear allowing
+you to add as many motifs as you need.
.. image:: images/motif_dialog_enter_motif.png
:alt: Enter Motif
:align: center
Now choose a color for your motif by clicking on the colored area to
-the left of the motif. In the image above, you would click on the blue
-square, but by default the squares will be white. Remember to choose a
-color that will show up well with a black bar as the background.
+the left of the name field. Remember to choose a color that will show
+up well with a black bar as the background. A good tool for picking a
+color is the `Colour Contrast Analyser
+<http://juicystudio.com/services/colourcontrast.php>`_ by
+`juicystudio.com <http://juicystudio.com/>`_.
.. image:: images/color_chooser.png
:alt: Color Chooser
:align: center
-Once you have selected the color for your motif, click on the 'set
-motifs' button. Notice that if Mussa finds matches to your motif will
-now show up in the main Mussagl window.
+Once you have selected the color for your motif, click on the
+**'apply'** button. Notice that if Mussa finds matches to your motif
+will now show up in the main Mussa window.
Before Motif:
:alt: Sequence bar after motif
:align: center
+To save your motifs with your analysis, see the `save analysis`_
+section. To save your motifs to a file, see the `save motifs to file`_
+section.
-View Mussa Alignements
-----------------------
+
+View Mussa Alignments
+---------------------
Mussagl allows you to zoom in on Mussa alignments by selecting the set
of alignment(s) of interest. To do this, move the mouse near the
overlaping the alienment(s) of interest and then **let go** of the
*left mouse button*.
-In the example below, I started by left clicking on the area marked by
-a red dot (upper left corner of bounding box) and draging the mouse to
+In the example below, I started by left-clicking on the area marked by
+a red dot (upper left corner of bounding box) and dragging the mouse to
the area marked by a blue dot (lower right corner of the bounding box)
and letting go of the left mouse button.
:align: center
+Sub-analysis
+------------
+
+To run a sub-analysis **highlight** a section of sequence and *right
+click* on it and select **Add to subanalysis**. To the same for the
+sequences shown in orange in the screenshot below. Note that you **are
+NOT limited** to selecting more than one subsequence from the same
+sequence.
+
+.. image:: images/subanalysis_select_seqs.png
+ :alt: Subanalysis sequence selection
+ :align: center
+
+Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
+
+.. image:: images/subanalysis_dialog.png
+ :alt: Subanalysis Dialog
+ :align: center
+
+A new Mussa window will appear with the subanalysis of your sequences
+once it's done running. This may take a while if you selected large
+chunks of sequence with a loose threshold.
+
+.. image:: images/subanalysis_done.png
+ :alt: Subalaysis complete
+ :align: center
+
+
+Copying sequence to clipboard
+-----------------------------
+
+To copy a sequence to the clipboard, highlight a section of sequence,
+as shown in the screen shot below, and do one of the following:
+
+ * Select **Copy as FASTA** from the **Edit** menu.
+ * **Right-Click (Left-click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as FASTA**.
+ * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
+.. image:: images/copy_sequence.png
+ :alt: Copy sequence
+ :align: center
Saving to an Image
---------------------------------
-FIXME: Need to write this section
+ * Updated to build 419.
+
+To save your current mussa view to an image, select **File > Save to
+image...** as shown below.
+
+.. image:: images/save_to_image_menu.png
+ :alt: File > Save to image...
+ :align: center
+
+You can define the width and the height of the image to save. By
+default it will use the same size of your current view. Since the
+Mussa view is implemented using vectors, if you choose a larger size
+then your current view, Mussa will redraw at the higher resolution
+when saving. In other words, you get higher quality images when saving
+at a higher resolution.
+
+If you check the "Lock aspect ratio" check box, which I have circled
+in red, then when you change one value, say width, the other, height,
+will update automatically to keep the same aspect ratio.
+
+.. image:: images/save_to_image_dialog.png
+ :alt: Save to image dialog
+ :align: center
+
+Click save and choose a location and filename for your file.
+
+The valid image formats are:
+
+ * .png (default if no extension specified.)
+ * .jpg
Detailed Information
Sequences
~~~~~~~~~
-Mussa reads in sequences which are formatted in the fasta_
+Mussa reads in sequences which are formatted in the FASTA_
format. Mussa may take a long time to run (>10 minutes) if the total
bp length near 280Kb. Once mussa has run once, you can reload
previously run analyzes.
SEQUENCE_NUM <num>
# first sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
ANNOTATION <annotation_file_path>
SEQ_START <sequence_start>
# the second sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
# ANNOTATION <annotation_file_path>
SEQ_START <sequence_start>
# SEQ_END <sequence_end>
# third sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
# ANNOTATION <annotation_file_path>
# analyzes parameters: command line args -w -t will override these
"APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
"SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
to analyze"
- "SEQUENCE", "/fasta/filepath.fa", "N/A", "true", "Must define one
+ "SEQUENCE", "/FASTA/filepath.fa", "N/A", "true", "Must define one
sequence per SEQUENCE_NUM."
"ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
annotation file. See `annotation file format`_ section for more
information."
- "SEQ_START", "integer", "1", "false", "Optional index into fasta file"
- "SEQ_END", "integer", "1", "false", "Optional index into fasta file"
+ "SEQ_START", "integer", "1", "false", "Optional index into FASTA file"
+ "SEQ_END", "integer", "1", "false", "Optional index into FASTA file"
"WINDOW", "integer", "N/A", "true", "`Window Size`_"
"THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
New as of build 198:
- * The annotation format now supports fasta sequences embedded in the
+ * The annotation format now supports FASTA sequences embedded in the
annotation file as shown in the format example below. Mussagl will
take this sequence and look for an exact match of this sequence in
your sequences. If a match is found, it will label it with the name
- of from the fasta header.
+ of from the FASTA header.
Format:
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
- >Fasta Header
+ >FASTA Header
ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
.. _GPL: http://www.opensource.org/licenses/gpl-license.php
.. _wiki: http://mussa.caltech.edu
.. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
-.. _fasta: http://en.wikipedia.org/wiki/FASTA_format
-.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif
-
+.. _FASTA: http://en.wikipedia.org/wiki/fasta_format
+.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif
\ No newline at end of file
projects / mussa.git / blobdiff