==============
Mussagl Manual
==============
-------------------
-By Brandon W. King
-------------------
+---------------
+Brandon W. King
+---------------
+
+Last updated: Oct 18th, 2006
+
+Updated to Mussagl build: (In process to 424)
+
+
+.. Things to add
+ * New features / change log
+ * (DONE) Comment out anything isn't implemented yet.
+ * (DONE) List of features that will be implemented in the future.
+ * Look into the homology mapping of UCSC.
+ * Add toggle to genomes.
+ * Document why one fast record per region.
+ * How to deal with the hazards of small utrs vis motif finder. (Add warning)
+ * Add warning about saving FASTA file.
+ * Add a general principles section near the top
+ * Using comparison algorithm which will pickup all repeats
+ * Add info about repeatmasking
+ * Checking upstream and downstream genes for make sure you are in the right regions.
+ * Later on: look into Ensembl
+ * Look into method of homology instead of blating.
+ * Mention advantages of using mupa.
+ * Mention the difference between using arrows and scroll bar
+ * Document the color for motifs
+ * Update for Mac user left-click
-Last updated: March 23rd, 2006
+ * Wormbase/Flybase/mirBASE tutorials
-Updated to Mussagl build: 141
.. contents::
+Status
+======
+
+Major New Features
+------------------
+
+ * Build 381
+ * Analysis "Save As" feature
+
+Change Log
+----------
+
+.. INSERT CHANGE LOG HERE
+.. END INSERT CHANGE LOG
+
+Features to be Implemented
+--------------------------
+
+For an up-to-date list of features to be implemented visit:
+http://woldlab.caltech.edu/cgi-bin/mussa/roadmap
+
Introduction
============
What is Mussagl?
----------------
+Mussa is an N-way version of the FamilyRelations (which is a part of
+the Cartwheel project) 2-way comparative sequence analysis
+software. Given DNA sequence from N species, Mussa uses all possible
+pairwise comparions to derive an N-wise comparison. For example, given
+sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
+1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
+these comparisons, saving those that satisfy a transitivity
+requirement. The saved paths are then displayed in an interactive
+viewer.
Short History of Mussa
----------------------
-
Mussa Python/PMW Prototype
~~~~~~~~~~~~~~~~~~~~~~~~~~
+First Python/PMW based protoype.
Mussa C++/FLTK
~~~~~~~~~~~~~~
+A rewrite for speed purposes using C++ and FLTK GUI toolkit.
Mussagl C++/Qt/OpenGL
~~~~~~~~~~~~~~~~~~~~~
+Refactored version using the more elegant Qt GUI framework and
+OpenGL for hardware acceleration for those who have better graphics
+cards.
Getting Mussagl
===============
Download
--------
-Mussagl can be downloaded from http://mussa.caltech.edu/.
+Mussagl in binary form for OS X and Windows and/or source can be
+downloaded from http://mussa.caltech.edu/.
Install
-------
Mac OS X
~~~~~~~~
-Once you have downloaded the .dmg file, dubble click on it and follow
+Once you have downloaded the .dmg file, double click on it and follow
the install instructions.
FIXME: Mention how to launch the program.
Once you have downloaded the Mussagl installer, double click on the
installer and follow the install instructions.
-To start mussagl, launch the program from Start > Programs > Mussagl >
-Mussgl.
+To start Mussagl, launch the program from Start > Programs > Mussagl >
+Mussagl.
Linux
__ wiki_
+Obtaining Input Data
+====================
+
+If you already have your data, you can skip ahead to the the `Using
+Mussagl`_ section.
+
+Let's say you have a gene of interest called 'SMN1' and you want to
+know how the sequence surrounding the gene in multiple species is
+conserved. Guess what, that's what we are going to do, retrieve the
+DNA sequence for SMN1 and prepare it for using in Mussa.
+
+For more information about SMN1 visit `NCBI's OMIM
+<http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
+
+The SMN1 data retrieved in this section can be downloaded from the
+`Mussa Example Data
+<http://woldlab.caltech.edu/cgi-bin/mussa/wiki/ExampleData>`_ page if
+you prefer to skip this section of the manual.
+
+
+UCSC Genome Browser Method
+--------------------------
+
+There are many methods of retrieving DNA sequence, but for this
+example we will retrieve SMN1 through the UCSC genome browser located
+at http://genome.ucsc.edu/.
+
+
+.. image:: images/ucsc_genome_browser_home.png
+ :alt: UCSC Genome Browser
+ :align: center
+
+Step 1 - Find SMN1
+~~~~~~~~~~~~~~~~~~
+
+The first step in finding SMN1 is to use the **Gene Sorter** menu
+option which I have highlighted in orange below:
+
+.. image:: images/ucsc_menu_bar_gene_sorter.png
+ :alt: Gene Sorter Menu Option
+ :align: center
+
+Gene Sorter page:
+
+.. image:: images/ucsc_gene_sorter.png
+ :alt: Gene Sorter
+ :align: center
+
+We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
+
+.. image:: images/ucsc_gs_sort_name_sim.png
+ :alt: Gene Sorter - Name Similarity
+ :align: center
+
+After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
+
+.. image:: images/ucsc_gs_smn1.png
+ :alt: Gene
+ :align: center
+
+Press **Go!** and you should see the following page:
+
+.. image:: images/ucsc_gs_found.png
+ :alt: Found SMN1
+ :align: center
+
+Click on **SMN1** and you will be taking the gene expression atlas
+page.
+
+.. image:: images/ucsc_gs_genome_position.png
+ :alt: Gene expression atlas
+ :align: center
+
+Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
+position column**.
+
+Now we have found the location of SMN1 on human!
+
+.. image:: images/ucsc_gb_smn1_human.png
+ :alt: Genome Browser - SMN1 (human)
+ :align: center
+
+
+Step 2 - Download CDS/UTR sequence for annotations
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+Since we have found **SMN1**, this would be a convenient time to extract
+the DNA sequence for the CDS and UTRs of the gene to use it as an
+annotation_ in Mussa.
+
+**Click on SMN1** shown **between** the **two orange arrows** shown
+below.
+
+.. image:: images/ucsc_gb_smn1_human_click_smn1.png
+ :alt: Genome Browser - SMN1 (human) - Orange Arrows
+ :align: center
+
+You should find yourself at the SMN1 description page.
+
+.. image:: images/ucsc_gb_smn1_description_page.png
+ :alt: Genome Browser - SMN1 (human) - Description page
+ :align: center
+
+**Scroll down** until you get to the **Sequence section** and click on
+**Genomic (chr5:70,256,524-70,284,592)**.
+
+.. image:: images/ucsc_gb_smn1_human_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Sequence
+ :align: center
+
+You should now be at the **Genomic sequence near gene** page:
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Get genomic sequence
+ :align: center
+
+Make the following changes (highlighted in orange in the screenshot
+below):
+
+ 1. UNcheck **introns**.
+ (We only want to annotate CDS and UTRs.)
+ 2. Select **one FASTA record** per **region**.
+ (Mussa needs each CDS and UTR represented by one FASTA record per CDS/UTR).
+ 3. Select **CDS in upper case, UTR in lower case.**
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
+ :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
+ :align: center
+
+Now click the **submit** button. You will then see a FASTA file with
+many FASTA records representing the CDS and UTRS.
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
+ :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
+ :align: center
+
+Now you need to save the FASTA records to a **text file**. If you are
+using **Firefox** or **Internet Explorer 6+** click on the **File >
+Save As** menu option.
+
+**IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
+repeat **NOT Webpage Complete** (see screenshot below.)
+
+Type in **smn1_human_annot.txt** for the file name.
+
+.. image:: images/smn1_human_annot.png
+ :alt: Genome Browser - SMN1 (human) - sequence annotation file
+ :align: center
+
+**IMPORTANT:** You should open the file with a text editor and make
+ sure **no HTML** was saved... If you find any HTML markup, delete
+ the markup and save the file.
+
+Now we are going to **modify the file** you just saved to **add the
+name of the species** to the **annotation file**. All you have to do
+is **add a new line** at the **top of the file** with the word **'Human'** as
+shown below:
+
+.. image:: images/smn1_human_annot_plus_human.png
+ :alt: Genome Browser - SMN1 (human) - sequence annotation file
+ :align: center
+
+You can add more annotations to this file if you wish. See the
+`annotation file format`_ section for details of the file format. By
+including FASTA records in the annotation_ file, Mussa searches your
+DNA sequence for an exact match of the sequence in the annotation_
+file. If found, it will be marked as an annotation_ within Mussa.
+
+
+Step 3 - Download gene and upstream/downstream sequence
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+Use the back button in your web browser to get back the **genome
+browser view** of **SMN1** as shown below.
+
+.. image:: images/ucsc_gb_smn1_human.png
+ :alt: Genome Browser - SMN1 (human)
+ :align: center
+
+There are two options for getting additional sequence around your
+gene. The more complex way is to zoom out so that you have the
+sequence you want being shown in the genome browser and then follow
+the directions for the following method.
+
+The second option, which we will choose, is to leave the genome
+browser zoomed exactly at the location of SMN1 and click on the
+**DNA** option on the menu bar (shown with orange arrows in the
+screenshot below.)
+
+.. image:: images/ucsc_gb_smn1_human_dna_option.png
+ :alt: Genome Browser - SMN1 (human) - DNA Option
+ :align: center
+
+Now in the **get dna in window** page, let's add an arbitrary amount of
+extra sequence on to each end of the gene, let's say 5000 base pairs.
+
+.. image:: images/ucsc_gb_smn1_human_get_dna.png
+ :alt: Genome Browser - SMN1 (human) - Get DNA
+ :align: center
+
+Click the **get DNA** button.
+
+.. image:: images/ucsc_gb_smn1_human_dna.png
+ :alt: Genome Browser - SMN1 (human) - DNA
+ :align: center
+
+Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
+did in step 2 with the annotation file.
+
+**IMPORTANT:** Make sure the file is saved as a text file and not an
+HTML file. Open the file with a text editor and remove any HTML markup
+you find.
+
+
+Step 4 - Same/similar/related gene other species.
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+What good is a multiple sequence alignment viewer without multiple
+sequences? Let'S find a similar gene in a few more species.
+
+Use the back button on your web browser until you get the **genome
+browser view** of **SMN1** as shown below.
+
+.. image:: images/ucsc_genome_browser_home.png
+ :alt: UCSC Genome Browser
+ :align: center
+
+**Click on SMN1** shown **between** the **two orange arrows** shown
+below.
+
+.. image:: images/ucsc_gb_smn1_human_click_smn1.png
+ :alt: Genome Browser - SMN1 (human) - Orange Arrows
+ :align: center
+
+You should find yourself at the SMN1 description page.
+
+.. image:: images/ucsc_gb_smn1_description_page.png
+ :alt: Genome Browser - SMN1 (human) - Description page
+ :align: center
+
+**Scroll down** until you get to the **Sequence section** and click on
+**Protein (262 aa)**.
+
+.. image:: images/ucsc_gb_smn1_human_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Sequence
+ :align: center
+
+Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
+> Copy** option from the menu.
+
+.. image:: images/smn1_human_protein.png
+ :alt: Genome Browser - SMN1 (human) - Protein
+ :align: center
+
+Press the back button on the web browser once and then scroll to the
+top of the page and click on the **BLAT** option on the menu bar
+(shown below with orange arrows).
+
+.. image:: images/ucsc_gb_smn1_human_blat.png
+ :alt: Genome Browser - SMN1 (human) - Blat
+ :align: center
+
+**Paste** in the **protein sequence** and **change** the **genome** to
+**mouse** as shown below and then click **submit**.
+
+.. image:: images/ucsc_gb_smn1_human_blat_paste.png
+ :alt: Genome Browser - SMN1 (human) - Blat paste protein
+ :align: center
+
+Notice that we have two hits, one of which looks pretty good at 89.9%
+match.
+
+.. image:: images/ucsc_gb_smn1_human_blat_hits.png
+ :alt: Genome Browser - SMN1 (human) - Blat hits
+ :align: center
+
+**Click** on the **brower** link next to the 89.9% match. Notice in
+the genome browser (shown below) that there is an annotated gene
+called SMN1 for mouse which matches the line called **your sequence
+from blat search**. This means we are fairly confidant we found the
+right location in the mouse genome.
+
+.. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
+ :alt: Genome Browser - SMN1 (human) - Blat to browser
+ :align: center
+
+Follow steps 1 through 3 for mouse and then repeat step 4 with the
+human protein sequence to find **SMN1** in the following species (if
+you find a match):
+
+ 1. Rat
+ 2. Rabbit
+ 3. Dog
+ 4. Armadillo
+ 5. Elephant
+ 6. Opposum
+ 7. x_tropicalis
+
+Make sure to save the extended DNA sequence and annotation file for
+each one.
+
Using Mussagl
=============
Create/Load Analysis
----------------------
-Currently there are three ways to load a mussa experiment.
+Currently there are three ways to load a Mussa experiment.
1. `Create a new analysis`_
2. `Load a mussa parameter file`_ (.mupa)
Instructions:
- 1. **Give the experiement a name**, for this demo, we'll use
+ 1. **Give the experiment a name**, for this demo, we'll use
'demo_w30_t20'. Mussa will create a folder with this name to store
the analysis files in once it has been run.
- 2. Choose a `window size`_. For this demo **choose 30**.
-
- 3. Choose a threshold_... for this demo **choose 20**. See the
+ 2. Choose a threshold_... for this demo **choose 20**. See the
Threshold_ section for more detailed information.
+ 3. Choose a `window size`_. For this demo **choose 30**.
+
+
4. Choose the number of sequences_ you would like. For this demo
**choose 3**.
:alt: Steps 1-4
:align: center
-Now click on the 'Browse' button next to the sequence input box and
-then select /examples/seq/human_mck_pro.fa file. Do the same in the
-next two sequence input boxes selecting mouse_mck_pro.fa and
-rabbit_mck_pro.fa as shown below.
+First enter the species name of "Human" in the first "Species" text
+box. Now click on the 'Browse' button next to the sequence input box
+and then select /examples/seq/human_mck_pro.fa file. Do the same in
+the next two sequence input boxes selecting mouse_mck_pro.fa and
+rabbit_mck_pro.fa as shown below. Make sure to give them a species
+name as well. Note that you can create annotation files using the
+mussa `Annotation File Format`_ to add annotations to your sequence.
.. image:: images/define_analysis_step2.png
:alt: Choose sequences
:alt: Mussagl Demo
:align: center
-This analysis is now saved in a directory called **demo_w30_t20** in
-the current working directory. If you close and reopen Mussagl, you
-can reload the saved analysis. See `Load an analysis`_ section below
-for details.
+By default your analysis is NOT saved. If you try to close an analysis
+without saving, you will be prompted with a dialog box asking you if
+you would like to save your analysis. The `Saving`_ section for
+details on saving your analysis. When saving, choose directory and
+give the analysis the name **demo_w30_t20**. If you close and reopen
+Mussagl, you will then be able to load the saved analysis. See `Load
+an analysis`_ section below for details.
Load a mussa parameter file
parameter file. See the `Parameter File Format`_ section for details
on creating a .mupa file.
-Once you have a .mupa file created, load Mussgl and select the **File >
-Load Mussa Parameters** menu option. Select the .mupa file and click
+Once you have a .mupa file created, load Mussagl and select the **File >
+Create Analysis from File** menu option. Select the .mupa file and click
open.
.. image:: images/load_mupa_menu.png
~~~~~~~~~~~~~~~~
To load a previously run analysis open Mussagl and select the **File >
-Load Analysis** menu option. Select an analysis **directory** and
+Open Existing Analysis** menu option. Select an analysis **directory** and
click open.
.. image:: images/load_analysis_menu.png
:align: center
-Detailed Info
--------------
+Main Window
+-----------
+
+Overview
+~~~~~~~~
+.. Screen-shot with numbers showing features.
+
+.. image:: images/window_overview.png
+ :alt: Mussa Window
+ :align: center
+
+Legend:
+
+ 1. `DNA Sequence (Black bars)`_
+
+ 2. Annotation_
+
+ 3. Motif_
+
+ 4. `Red conservation tracks`_
+
+ 5. `Blue conservation tracks`_
+
+ 6. `Zoom Factor`_ (Base pairs per pixel)
+
+ 7. `Dynamic Threshold`_
+
+ 8. `Sequence Information Bar`_
+
+ 9. `Sequence Scroll Bar`_
+
+
+DNA Sequence (black bars)
+~~~~~~~~~~~~~~~~~~~~~~~~~
+
+.. image:: images/sequence_bar.png
+ :alt: Sequence Bar
+ :align: center
+
+Each of the black bars represents one of the loaded sequences, in this
+case the sequence around the gene 'MCK' in human, mouse, and rabbit.
+
+
+Annotation
+~~~~~~~~~~
+
+.. figure:: images/annotation.png
+ :alt: Annotation
+ :align: center
+
+ Annotation shown in green on sequence bar.
+
+
+Annotations can be included on any of the sequences using the `Load a
+mussa parameter file`_ or `Create a new analysis`_ method of loading
+your sequences. You can define annotations by location or using an
+exact sub-sequence or a FASTA sequence of the section of DNA you wish
+to annotate. See the `Annotation File Format`_ section for details.
+
+
+Motif
+~~~~~
+
+.. figure:: images/motif.png
+ :alt: Motif
+ :align: center
+
+ Motif shown in light blue on sequence bar.
+
+The only real difference between an annotation and motif in Mussagl is
+that you can define motifs and choose a color from within the GUI. See
+the `Motifs`_ section for more information.
+
+
+Red conservation tracks
+~~~~~~~~~~~~~~~~~~~~~~~
+
+.. figure:: images/conservation_tracks.png
+ :alt: Conservation Tracks
+ :align: center
+
+ Conservations tracks shown as red and blue lines between sequence
+ bars.
+
+The **red lines** between the sequence bars represent conservation
+between the sequences (i.e. not reverse complement matches)
+
+The amount of sequence conservation shown will depend on how much your
+sequences are related and the `dynamic threshold`_ you are using.
+
+
+Blue conservation tracks
+~~~~~~~~~~~~~~~~~~~~~~~~
+
+.. figure:: images/conservation_tracks.png
+ :alt: Conservation Tracks
+ :align: center
+
+ Conservations tracks shown as red and blue lines between sequence
+ bars.
+
+**Blue lines** represent **reverse complement** conservation relative
+to the sequence attached to the top of the blue line.
+
+The amount of sequence conservation shown will depend on how much your
+sequences are related and the `dynamic threshold`_ you are using.
+
+
+Zoom Factor
+~~~~~~~~~~~
+
+.. image:: images/zoom_factor.png
+ :alt: Zoom Factor
+ :align: center
+
+The zoom factor represents the number of base pairs represented per
+pixel. When you zoom in far enough the sequence will switch from
+seeing a black bar, representing the sequence, to the actual sequence
+(well, ASCII representation of sequence).
+
+
+Dynamic Threshold
+~~~~~~~~~~~~~~~~~
+
+.. image:: images/dynamic_threshold.png
+ :alt: Dynamic Threshold
+ :align: center
+
+You can dynamically change the threshold for how strong a match you
+consider the conservation to be by changing the value in the dynamic
+threshold box.
+
+The value you enter is the minimum number of base pairs that have to
+be matched in order to be considered conserved. The second number that
+you can't change is the `window size`_ you used when creating the
+experiment. The last number is the percent match.
+
+See the Threshold_ section for more information.
+
+
+Sequence Information Bar
+~~~~~~~~~~~~~~~~~~~~~~~~
+
+.. image:: images/seq_info_bar.png
+ :alt: Sequence Information Bar
+ :align: center
+
+The sequence information bars can be found to the left and right sides
+of Mussagl. Next to each sequence you will find the following
+information:
+
+ 1. Species (If it has been defined)
+ 2. Total Size of Sequence
+ 3. Current base pair position
+
+Note that you can **update the species** text box. Make sure to **save your
+experiment** after making this change by selecting **File > Save
+Analysis** from the menu.
+
+Sequence Scroll Bar
+~~~~~~~~~~~~~~~~~~~
+
+.. image:: images/scroll_bar.png
+ :alt: Sequence Scroll Bar
+ :align: center
+
+The scroll bar allows you to scroll through the sequence which is
+useful when you have zoomed in using the `zoom factor`_.
+
+
+Saving
+------
+
+Save on Close
+~~~~~~~~~~~~~
+
+When ever you create a new analysis or make a change such as
+adding/editing a motif or changing a species name, an asterisk (*)
+will appear in the title of the window showing that there are changes
+that have not been saved. If you close a Mussa window without saving
+changes, Mussa will ask you if you would like to save the changes that
+have been made.
+
+Save Analysis
+~~~~~~~~~~~~~
+
+After making changes, such as updating species names or adding/editing
+motifs, you can save these changes by selecting the **File > Save
+analysis** menu option or pressing **CTRL + S** (PC) or
+**Apple/Command Key + S** (on Mac).
+
+.. image:: images/save_analysis.png
+ :alt: Save analysis
+ :align: center
+
+Save Analysis As
+~~~~~~~~~~~~~~~~
+
+To save a copy of your analysis to a new location, select the **File >
+Save analysis as** menu option and choose a new location and name for
+your analysis.
+
+.. image:: images/save_analysis_as.png
+ :alt: Save analysis
+ :align: center
+
+Save Motif List
+~~~~~~~~~~~~~~~
+
+See `Save Motifs to File`_ in the `Motifs`_ section.
+
+
+Viewing Multiple Analyses
+-------------------------
+
+Some times it is useful to view more than one analysis at a time. To
+do accomplish this, Mussa allows you to open a new Mussa window by
+selecting the **File > New Mussa Window** menu option.
+
+.. image:: images/new_mussa_window_menu.png
+ :alt: New Mussa Window Menu Option
+ :align: center
+
+A new Mussa window will pop up.
+
+.. figure:: images/new_mussa_window.png
+ :alt: New Mussa Window
+ :align: center
+
+ A new Mussa window on the right, in which I have loaded a second
+ experiment.
+
+Now you can create or load an existing analysis, in this new window,
+as described in the `Create/Load Analysis`_ section.
+
+You can view as many analyses as you can fit on your screen or until
+you run out of available RAM. If you notice a rapid decrease in
+performance and hear lots of noise coming from your hard drive, you
+probably ran out of RAM and are now using virtual memory (i.e. much
+much slower). If this happens, you may need to avoid opening as many
+analyses at one time.
+
+
+Annotations / Motifs
+--------------------
+
+Annotations
+~~~~~~~~~~~
+
+Currently annotations can be added to a sequence using the mussa
+`annotation file format`_ and can be loaded by selecting the
+annotation file when defining a new analysis (see `Create a new
+analysis`_ section) or by defining a .mupa file pointing to your
+annotation file (see `Load a mussa parameter file`_ section).
+
+Motifs
+~~~~~~
+
+Load Motifs from File
+*********************
+
+It is possible to load motifs from a file which was saved from a
+previous run or by defining your own motif file. See the `Motif File
+Format`_ section for details.
+
+NOTE: Valid motif list file extensions are:
+
+ * .mtl
+ * .txt
+
+To load a motif file, select **Load Motif List** item from the
+**File** menu and select a motif list file.
+
+.. image:: images/load_motif.png
+ :alt: Load Motif List
+ :align: center
+
+
+Save Motifs to File
+*******************
+
+Motifs from the `Motif Dialog`_ can be saved to file for use with
+other analyses. If you just want your motifs to be saved with your
+analysis, see the `save analysis`_ section for details.
+
+To save a motif list, select **File > Save Motifs** menu option. By
+default, Mussa will append .mtl if you do not provide a file extension
+(valid file extensions: .mtl & .txt).
+
+.. image:: images/save_motifs.png
+ :alt: Save Motifs
+ :align: center
+
+
+Motif Dialog
+************
+
+Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
+Code`_ for defining a motif. To define a motif, select **Edit > Edit
+Motifs** menu item as shown below.
+
+.. image:: images/view_edit_motifs.png
+ :alt: "View > Edit Motifs" Menu
+ :align: center
+
+You will see a dialog box appear with a "apply" button in the bottom
+right and one rows for defining motifs and the color that will be
+displayed on the sequence. When you start adding your first motif, an
+additional row will be added. The check box in the first column
+defines whether the motif is displayed or not. The second column is
+the motif display color. The third column is for the name of your
+motif and finally, the fourth column is motif itself.
+
+.. image:: images/motif_dialog_start.png
+ :alt: Motif Dialog
+ :align: center
+
+Now let's make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
+Code`_, type in **'ATSCT'** into the motif field and **'My Motif'** for
+the name in the name field as shown below.
+
+Notice how a second row appeared when you started to add the first
+motif. Every time you add a new motif, a new row will appear allowing
+you to add as many motifs as you need.
+
+.. image:: images/motif_dialog_enter_motif.png
+ :alt: Enter Motif
+ :align: center
+
+Now choose a color for your motif by clicking on the colored area to
+the left of the name field. Remember to choose a color that will show
+up well with a black bar as the background. A good tool for picking a
+color is the `Colour Contrast Analyser
+<http://juicystudio.com/services/colourcontrast.php>`_ by
+`juicystudio.com <http://juicystudio.com/>`_.
+
+.. image:: images/color_chooser.png
+ :alt: Color Chooser
+ :align: center
+
+Once you have selected the color for your motif, click on the
+**'apply'** button. Notice that if Mussa finds matches to your motif
+will now show up in the main Mussa window.
+
+Before Motif:
+
+.. image:: images/motif_dialog_bar_before.png
+ :alt: Sequence bar before motif
+ :align: center
+
+After Motif:
+
+.. image:: images/motif_dialog_bar_after.png
+ :alt: Sequence bar after motif
+ :align: center
+
+To save your motifs with your analysis, see the `save analysis`_
+section. To save your motifs to a file, see the `save motifs to file`_
+section.
+
+Deleting a Motif
+^^^^^^^^^^^^^^^^
+
+To delete a motif, remove all text from the name and sequence columns
+and close the motif editor.
+
+View Mussa Alignments
+---------------------
+
+Mussagl allows you to zoom in on Mussa alignments by selecting the set
+of alignment(s) of interest. To do this, move the mouse near the
+alignment you are interested in viewing and then **PRESS** and
+**HOLD** the **LEFT mouse button** and **drag the mouse** to the other
+side of the conservation track so that you see a bounding box
+overlaping the alienment(s) of interest and then **let go** of the
+*left mouse button*.
+
+In the example below, I started by left-clicking on the area marked by
+a red dot (upper left corner of bounding box) and dragging the mouse to
+the area marked by a blue dot (lower right corner of the bounding box)
+and letting go of the left mouse button.
+
+.. image:: images/select_sequence.png
+ :alt: Select Sequence
+ :align: center
+
+All of the lines which were not selected should be washed out as shown
+below:
+
+.. image:: images/washed_out.png
+ :alt: Tracks washed out
+ :align: center
+
+With a selection made, goto the **View** menu and select **View mussa alignment**.
+
+.. image:: images/view_mussa_alignment.png
+ :alt: View mussa alignment
+ :align: center
+
+You should see the alignment at the base-pair level as shown below.
+
+.. image:: images/mussa_alignment.png
+ :alt: Mussa alignment
+ :align: center
+
+
+Sub-analysis
+------------
+
+To run a sub-analysis **highlight** a section of sequence and *right
+click* on it and select **Add to subanalysis**. To the same for the
+sequences shown in orange in the screenshot below. Note that you **are
+NOT limited** to selecting more than one subsequence from the same
+sequence.
+
+.. image:: images/subanalysis_select_seqs.png
+ :alt: Subanalysis sequence selection
+ :align: center
+
+Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
+
+.. image:: images/subanalysis_dialog.png
+ :alt: Subanalysis Dialog
+ :align: center
+
+A new Mussa window will appear with the subanalysis of your sequences
+once it's done running. This may take a while if you selected large
+chunks of sequence with a loose threshold.
+
+.. image:: images/subanalysis_done.png
+ :alt: Subalaysis complete
+ :align: center
+
+
+Copying sequence to clipboard
+-----------------------------
+
+To copy a sequence to the clipboard, highlight a section of sequence,
+as shown in the screen shot below, and do one of the following:
+
+ * Select **Copy as FASTA** from the **Edit** menu.
+ * **Right-Click (Left-click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as FASTA**.
+ * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
+
+.. image:: images/copy_sequence.png
+ :alt: Copy sequence
+ :align: center
+
+
+Saving to an Image
+---------------------------------
+
+ * Updated to build 419.
+
+To save your current mussa view to an image, select **File > Save to
+image...** as shown below.
+
+.. image:: images/save_to_image_menu.png
+ :alt: File > Save to image...
+ :align: center
+
+You can define the width and the height of the image to save. By
+default it will use the same size of your current view. Since the
+Mussa view is implemented using vectors, if you choose a larger size
+then your current view, Mussa will redraw at the higher resolution
+when saving. In other words, you get higher quality images when saving
+at a higher resolution.
+
+If you check the "Lock aspect ratio" check box, which I have circled
+in red, then when you change one value, say width, the other, height,
+will update automatically to keep the same aspect ratio.
+
+.. image:: images/save_to_image_dialog.png
+ :alt: Save to image dialog
+ :align: center
+
+Click save and choose a location and filename for your file.
+
+The valid image formats are:
+
+ * .png (default if no extension specified.)
+ * .jpg
+
+
+Detailed Information
+--------------------
Threshold
~~~~~~~~~
-The threshold of an analysis is in minimum number of base pair
-matches must be meet to in order to be kept as a match. Note that you
-can vary the threshold from within Mussagl. For example, if you
-choose a `window size`_ of **30** and a **threshold** of **20** the mussa
-nway transitive algorithm will store all matches that are 20 out of 30
-bp matches or better and pass it on to Mussagl. Mussagl will
-then allow you to dynamically choose a threshold from 10 to 30 base
-pairs. A threshold of 30 bps would only show 30 out of 30 bp
-matches. A threshold of 20 bps would show all matches of 20 out of 30
-bps or better. Choosing a threshold below 20 in this case won't have
-an effect [*]_ because the mussa algorithm didn't report and matches below
-this threshold.
-
-.. [*] In the future, Mussagl will automatically detect the minimum
- threshold which was used when defining an analysis and not allow
- you to select a threshold below the minimum. See `ticket #52
- <http://woldlab.caltech.edu/cgi-bin/mussa/ticket/52>`_ for more
- info.
+The threshold of an analysis is in minimum number of base pair matches
+must be meet to in order to be kept as a match. Note that you can vary
+the threshold from within Mussagl. For example, if you choose a
+`window size`_ of **30** and a **threshold** of **20** the mussa nway
+transitive algorithm will store all matches that are 20 out of 30 bp
+matches or better and pass it on to Mussagl. Mussagl will then allow
+you to dynamically choose a threshold from 20 to 30 base pairs. A
+threshold of 30 bps would only show 30 out of 30 bp matches. A
+threshold of 20 bps would show all matches of 20 out of 30 bps or
+better. If you would like to see results for matches lower than 20 out
+of 30, you will need to rerun the analysis with a lower threshold.
Window Size
~~~~~~~~~~~
-The typical sizes people tend to choose are between 20 and 30. Feel
-free to analysis with this setting depending on your needs.
+The typical sizes people tend to choose are between 20 and 30. You
+will likely need to experiment with this setting depending on your
+needs and input sequence.
Sequences
~~~~~~~~~
-Mussa reads in sequences which are formated in the fasta_
+Mussa reads in sequences which are formatted in the FASTA_
format. Mussa may take a long time to run (>10 minutes) if the total
bp length near 280Kb. Once mussa has run once, you can reload
-previously run analyses.
+previously run analyzes.
+
+FIXME: We have learned more about how much sequence and how many to
+put in Mussagl, this information should be documented here.
Mussa File Formats
::
- # name of anaylsis directory and stem for associated files
+ # name of analysis directory and stem for associated files
ANA_NAME <analysis_name>
# if APPEND vars true, a _wXX and/or _tYY added to analysis name
SEQUENCE_NUM <num>
# first sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
ANNOTATION <annotation_file_path>
SEQ_START <sequence_start>
# the second sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
# ANNOTATION <annotation_file_path>
SEQ_START <sequence_start>
# SEQ_END <sequence_end>
# third sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
# ANNOTATION <annotation_file_path>
- # analyses parameters: command line args -w -t will override these
+ # analyzes parameters: command line args -w -t will override these
WINDOW <num>
THRESHOLD <num>
"APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
"APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
"SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
- to analyse"
- "SEQUENCE", "/fasta/filepath.fa", "N/A", "true", "Must define one
+ to analyze"
+ "SEQUENCE", "/FASTA/filepath.fa", "N/A", "true", "Must define one
sequence per SEQUENCE_NUM."
"ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
annotation file. See `annotation file format`_ section for more
information."
- "SEQ_START", "integer", "1", "false", "Optional index into fasta file"
- "SEQ_END", "integer", "1", "false", "Optional index into fasta file"
+ "SEQ_START", "integer", "1", "false", "Optional index into FASTA file"
+ "SEQ_END", "integer", "1", "false", "Optional index into FASTA file"
"WINDOW", "integer", "N/A", "true", "`Window Size`_"
"THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
~~~~~~~~~~~~~~~~~~~~~~
The first line in the file is the sequence name. Each line there after
-is a **space** seperated annotation.
+is a **space** separated annotation.
+
+New as of build 198:
+
+ * The annotation format now supports FASTA sequences embedded in the
+ annotation file as shown in the format example below. Mussagl will
+ take this sequence and look for an exact match of this sequence in
+ your sequences. If a match is found, it will label it with the name
+ of from the FASTA header.
Format:
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
+ >FASTA Header
+ ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
+ ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
+ TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
+ ACGTACGGCAGTACGCGGTCAGA
+ <start> <stop> <annotation_name> <annotation_type>
...
Example:
251 500 Glorp Glorptype
751 1000 Glorp Glorptype
1251 1500 Glorp Glorptype
+ >My favorite DNA sequence
+ GATTACA
1751 2000 Glorp Glorptype
-.. _motif:
+.. _motif_file_format:
Motif File Format
~~~~~~~~~~~~~~~~~
Format:
<motif> <red> <green> <blue>
+
+Example:
+
GGCC 0.0 1 1
+
+IUPAC Nucleotide Code
+~~~~~~~~~~~~~~~~~~~~~~
+
+For your convenience, below is a table of the IUPAC Nucleotide Code.
+
+The following table is table 1 from "Nomenclature for Incompletely
+Specified Bases in Nucleic Acid Sequences" which can be found at
+http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.
+
+====== ================= ===================================
+Symbol Meaning Origin of designation
+====== ================= ===================================
+G G Guanine
+A A Adenine
+T T Thymine
+C C Cytosine
+R G or A puRine
+Y T or C pYrimidine
+M A or C aMino
+K G or T Keto
+S G or C Strong interaction (3 H bonds)
+W A or T Weak interaction (2 H bonds)
+H A or C or T not-G, H follows G in the alphabet
+B G or T or C not-A, B follows A
+V G or C or A not-T (not-U), V follows U
+D G or A or T not-C, D follows C
+N G or A or T or C aNy
+====== ================= ===================================
+
+
.. Define links below
------------------
.. _GPL: http://www.opensource.org/licenses/gpl-license.php
.. _wiki: http://mussa.caltech.edu
.. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
-.. _fasta: http://en.wikipedia.org/wiki/FASTA_format
-
+.. _FASTA: http://en.wikipedia.org/wiki/fasta_format
+.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif
\ No newline at end of file