==============
Mussagl Manual
==============
-------------------
-By Brandon W. King
-------------------
+---------------
+Brandon W. King
+---------------
-Last updated: March 23rd, 2006
+Last updated: May 18th, 2006
-Updated to Mussagl build: 141
+Updated to Mussagl build: 141 (Update to 200 in progress)
.. contents::
Download
--------
-Mussagl can be downloaded from http://mussa.caltech.edu/.
+Mussagl in binary form for OS X and Windows and/or source can be
+downloaded from http://mussa.caltech.edu/.
Install
-------
Mac OS X
~~~~~~~~
-Once you have downloaded the .dmg file, dubble click on it and follow
+Once you have downloaded the .dmg file, double click on it and follow
the install instructions.
FIXME: Mention how to launch the program.
Once you have downloaded the Mussagl installer, double click on the
installer and follow the install instructions.
-To start mussagl, launch the program from Start > Programs > Mussagl >
-Mussgl.
+To start Mussagl, launch the program from Start > Programs > Mussagl >
+Mussagl.
Linux
Create/Load Analysis
----------------------
-Currently there are three ways to load a mussa experiment.
+Currently there are three ways to load a Mussa experiment.
1. `Create a new analysis`_
2. `Load a mussa parameter file`_ (.mupa)
Instructions:
- 1. **Give the experiement a name**, for this demo, we'll use
+ 1. **Give the experiment a name**, for this demo, we'll use
'demo_w30_t20'. Mussa will create a folder with this name to store
the analysis files in once it has been run.
Now click on the 'Browse' button next to the sequence input box and
then select /examples/seq/human_mck_pro.fa file. Do the same in the
next two sequence input boxes selecting mouse_mck_pro.fa and
-rabbit_mck_pro.fa as shown below.
+rabbit_mck_pro.fa as shown below. Note that you can create annotation
+files using the mussa `Annotation File Format` to add annotations to
+your sequence.
.. image:: images/define_analysis_step2.png
:alt: Choose sequences
parameter file. See the `Parameter File Format`_ section for details
on creating a .mupa file.
-Once you have a .mupa file created, load Mussgl and select the **File >
+Once you have a .mupa file created, load Mussagl and select the **File >
Load Mussa Parameters** menu option. Select the .mupa file and click
open.
:align: center
-Detailed Info
--------------
+Main Window
+-----------
+
+Overview
+~~~~~~~~
+.. Screen-shot with numbers showing features.
+
+.. image:: images/window_overview.png
+ :alt: Mussa Window
+ :align: center
+
+Legend:
+
+ 1. `DNA Sequence (Black bars)`_
+
+ 2. Annotation_
+
+ 3. Motif_
+
+ 4. `Conservation tracks`_
+
+ 5. `Motif Toggle`_
+
+ 6. `Zoom Factor`_ (Base pairs per pixel)
+
+ 7. `Dynamic Threshold`_
+
+ 8. `Sequence Information Bar`_
+
+ 9. `Sequence Scroll Bar`_
+
+
+DNA Sequence (black bars)
+~~~~~~~~~~~~~~~~~~~~~~~~~
+
+.. image:: images/sequence_bar.png
+ :alt: Sequence Bar
+ :align: center
+
+Each of the black bars represents one of the loaded sequences, in this
+case the sequence around the gene 'MCK' in human, mouse, and rabbit.
+
+FIXME: Should I mention the repeats here?
+
+
+Annotation
+~~~~~~~~~~
+
+.. figure:: images/annotation.png
+ :alt: Annotation
+ :align: center
+
+ Annotation shown in green on sequence bar.
+
+
+Annotations can be included on any of the sequences using the `Load a
+mussa parameter file`_ method of loading your sequences. You can
+define annotations by location or using an exact sub-sequence and you
+may also choose any color for display of the annotation; see the
+`Annotation File Format`_ section for details.
+
+Note: Currently there is no way to add annotations using the GUI (only
+via the .mupa file). We plan to add this feature in the future, but it
+likely will not make it into the first release.
+
+
+Motif
+~~~~~
+
+.. figure:: images/motif.png
+ :alt: Motif
+ :align: center
+
+ Motif shown in light blue on sequence bar.
+
+The only real difference between an annotation and motif in Mussagl is
+that you can define motifs from within the GUI. See the `Motifs`_
+section for more information.
+
+
+Conservation tracks
+~~~~~~~~~~~~~~~~~~~
+
+.. figure:: images/conservation_tracks.png
+ :alt: Conservation Tracks
+ :align: center
+
+ Conservations tracks shown as red and blue lines between sequence
+ bars.
+
+The **red lines** between the sequence bars represent conservation
+between the sequences and **blue lines** represent **reverse
+complement** conservation. The amount of sequence conservation shown
+will depend on the relatedness of your sequences and the `dynamic
+threshold` you are using. Sequences with lots of repeats will cause
+major slow downs in calculating the matches.
+
+
+Motif Toggle
+~~~~~~~~~~~~
+
+.. image:: images/motif_toggle.png
+ :alt: Motif Toggle
+ :align: center
+
+Toggles motifs on and off. This will not turn on and off annotations.
+
+Note: As of the current build (#200), this feature hasn't been
+implemented.
+
+
+Zoom Factor
+~~~~~~~~~~~
+
+.. image:: images/zoom_factor.png
+ :alt: Zoom Factor
+ :align: center
+
+The zoom factor represents the number of base pairs represented per
+pixel. When you zoom in far enough the sequence will switch from
+seeing a black bar, representing the sequence, to the actual sequence
+(well, ASCII representation of sequence).
+
+
+Dynamic Threshold
+~~~~~~~~~~~~~~~~~
+
+.. image:: images/dynamic_threshold.png
+ :alt: Dynamic Threshold
+ :align: center
+
+You can dynamically change the threshold for how strong of match you
+consider the conservation to be with one of two options:
+
+ 1. Number of base pair matches out of window size.
+
+ 2. Percent base pair conservation.
+
+See the Threshold_ section for more information.
+
+
+Sequence Information Bar
+~~~~~~~~~~~~~~~~~~~~~~~~
+
+.. image:: images/seq_info_bar.png
+ :alt: Sequence Information Bar
+ :align: center
+
+The sequence information bars can be found to the left and right sides
+of Mussagl. Next to each sequence you will find the following
+information:
+
+ 1. Species (If it has been defined)
+ 2. Total Size of Sequence
+ 3. Current base pair position
+
+
+Sequence Scroll Bar
+~~~~~~~~~~~~~~~~~~~
+
+.. image:: images/scroll_bar.png
+ :alt: Sequence Scroll Bar
+ :align: center
+
+The scroll bar allows you to scroll through the sequence which is
+useful when you have zoomed in using the `zoom factor`_.
+
+
+Annotations / Motifs
+--------------------
+
+Annotations
+~~~~~~~~~~~
+
+Currently annotations can be added to a sequence using the mussa
+`annotation file format`_ and can be loaded by selecting the
+annotation file when defining a new analysis (see `Create a new
+analysis`_ section) or by defining a .mupa file pointing to your
+annotation file (see `Load a mussa parameter file`_ section).
+
+Motifs
+~~~~~~
+
+Load Motifs from File
+*********************
+
+It is possible to load motifs from a file which was saved from a
+previous run or by defining your own motif file. See the `Motif File
+Format`_ section for details.
+
+To load a motif file, select **Load Motif List** item from the
+**File** menu and select a motif list file.
+
+.. image:: images/load_motif.png
+ :alt: Load Motif List
+ :align: center
+
+
+Save Motifs to File
+*******************
+
+Note: Currently not implemented
+
+
+Motif Dialog
+************
+
+Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
+Code`_ for defining a motif. To define a motif, select **View > Edit
+Motifs** menu item as shown below.
+
+.. image:: images/view_edit_motifs.png
+ :alt: "View > Edit Motifs" Menu
+ :align: center
+
+You will see a dialog box appear with a "set motifs" button and 10
+rows for defining motifs and the color that will be displayed on the
+sequence. By default all 10 motifs start off as with white as the
+color. In the image below, I changed the color from white to blue to
+make it easier to see.
+
+.. image:: images/motif_dialog_start.png
+ :alt: Motif Dialog
+ :align: center
+
+Now lets make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
+Code`_, type in **'ATSCT'** into the first box as shown below.
+
+.. image:: images/motif_dialog_enter_motif.png
+ :alt: Enter Motif
+ :align: center
+
+Now choose a color for your motif by clicking on the colored area to
+the left of the motif. In the image above, you would click on the blue
+square, but by default the squares will be white. Remember to choose a
+color that will show up well with a black bar as the background.
+
+.. image:: images/color_chooser.png
+ :alt: Color Chooser
+ :align: center
+
+Once you have selected the color for your motif, click on the 'set
+motifs' button. Notice that if Mussa finds matches to your motif will
+now show up in the main Mussagl window.
+
+Before Motif:
+
+.. image:: images/motif_dialog_bar_before.png
+ :alt: Sequence bar before motif
+ :align: center
+
+After Motif:
+
+.. image:: images/motif_dialog_bar_after.png
+ :alt: Sequence bar after motif
+ :align: center
+
+
+Detailed Information
+--------------------
Threshold
~~~~~~~~~
-The threshold of an analysis is in minimum number of base pair
-matches must be meet to in order to be kept as a match. Note that you
-can vary the threshold from within Mussagl. For example, if you
-choose a `window size`_ of **30** and a **threshold** of **20** the mussa
-nway transitive algorithm will store all matches that are 20 out of 30
-bp matches or better and pass it on to Mussagl. Mussagl will
-then allow you to dynamically choose a threshold from 10 to 30 base
-pairs. A threshold of 30 bps would only show 30 out of 30 bp
-matches. A threshold of 20 bps would show all matches of 20 out of 30
-bps or better. Choosing a threshold below 20 in this case won't have
-an effect [*]_ because the mussa algorithm didn't report and matches below
-this threshold.
-
-.. [*] In the future, Mussagl will automatically detect the minimum
- threshold which was used when defining an analysis and not allow
- you to select a threshold below the minimum. See `ticket #52
- <http://woldlab.caltech.edu/cgi-bin/mussa/ticket/52>`_ for more
- info.
+The threshold of an analysis is in minimum number of base pair matches
+must be meet to in order to be kept as a match. Note that you can vary
+the threshold from within Mussagl. For example, if you choose a
+`window size`_ of **30** and a **threshold** of **20** the mussa nway
+transitive algorithm will store all matches that are 20 out of 30 bp
+matches or better and pass it on to Mussagl. Mussagl will then allow
+you to dynamically choose a threshold from 20 to 30 base pairs. A
+threshold of 30 bps would only show 30 out of 30 bp matches. A
+threshold of 20 bps would show all matches of 20 out of 30 bps or
+better. If you would like to see results for matches lower than 20 out
+of 30, you will need to rerun the analysis with a lower threshold.
Window Size
~~~~~~~~~~~
-The typical sizes people tend to choose are between 20 and 30. Feel
-free to analysis with this setting depending on your needs.
+The typical sizes people tend to choose are between 20 and 30. You
+will likely need to experiment with this setting depending on your
+needs and input sequence.
Sequences
~~~~~~~~~
-Mussa reads in sequences which are formated in the fasta_
+Mussa reads in sequences which are formatted in the fasta_
format. Mussa may take a long time to run (>10 minutes) if the total
bp length near 280Kb. Once mussa has run once, you can reload
-previously run analyses.
+previously run analyzes.
+
+FIXME: We have learned more about how much sequence and how many to
+put in Mussagl, this information should be documented here.
Mussa File Formats
::
- # name of anaylsis directory and stem for associated files
+ # name of analysis directory and stem for associated files
ANA_NAME <analysis_name>
# if APPEND vars true, a _wXX and/or _tYY added to analysis name
SEQUENCE <fasta_file_path>
# ANNOTATION <annotation_file_path>
- # analyses parameters: command line args -w -t will override these
+ # analyzes parameters: command line args -w -t will override these
WINDOW <num>
THRESHOLD <num>
"APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
"APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
"SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
- to analyse"
+ to analyze"
"SEQUENCE", "/fasta/filepath.fa", "N/A", "true", "Must define one
sequence per SEQUENCE_NUM."
"ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
~~~~~~~~~~~~~~~~~~~~~~
The first line in the file is the sequence name. Each line there after
-is a **space** seperated annotation.
+is a **space** separated annotation.
+
+New as of build 198:
+
+ * The annotation format now supports fasta sequences embedded in the
+ annotation file as shown in the format example below. Mussagl will
+ take this sequence and look for an exact match of this sequence in
+ your sequences. If a match is found, it will label it with the name
+ of from the fasta header.
Format:
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
+ >Fasta Header
+ ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
+ ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
+ TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
+ ACGTACGGCAGTACGCGGTCAGA
+ <start> <stop> <annotation_name> <annotation_type>
...
Example:
251 500 Glorp Glorptype
751 1000 Glorp Glorptype
1251 1500 Glorp Glorptype
+ >My favorite DNA sequence
+ GATTACA
1751 2000 Glorp Glorptype
-.. _motif:
+.. _motif_file_format:
Motif File Format
~~~~~~~~~~~~~~~~~
Format:
<motif> <red> <green> <blue>
+
+Example:
+
GGCC 0.0 1 1
+
+IUPAC Nucleotide Code
+~~~~~~~~~~~~~~~~~~~~~~
+
+For your convenience, below is a table of the IUPAC Nucleotide Code.
+
+The following table is table 1 from "Nomenclature for Incompletely
+Specified Bases in Nucleic Acid Sequences" which can be found at
+http://www.chem.qmul.ac.uk/iubmb/misc/naseq.html.
+
+====== ================= ===================================
+Symbol Meaning Origin of designation
+====== ================= ===================================
+G G Guanine
+A A Adenine
+T T Thymine
+C C Cytosine
+R G or A puRine
+Y T or C pYrimidine
+M A or C aMino
+K G or T Keto
+S G or C Strong interaction (3 H bonds)
+W A or T Weak interaction (2 H bonds)
+H A or C or T not-G, H follows G in the alphabet
+B G or T or C not-A, B follows A
+V G or C or A not-T (not-U), V follows U
+D G or A or T not-C, D follows C
+N G or A or T or C aNy
+====== ================= ===================================
+
+
.. Define links below
------------------
.. _wiki: http://mussa.caltech.edu
.. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
.. _fasta: http://en.wikipedia.org/wiki/FASTA_format
+.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif