==============
Mussagl Manual
==============
-------------------
-By Brandon W. King
-------------------
+---------------
+Brandon W. King
+---------------
+
+Last updated: Sept 20th, 2006
+
+Updated to Mussagl build: 287 (In process to 381)
+
+
+.. Things to add
+ * New features / change log
+ * Comment out anything isn't implemented yet.
+ * (DONE) List of features that will be implemented in the future.
+ * Look into the homology mapping of UCSC.
+ * Add toggle to genomes.
+ * Document why one fast record per region.
+ * How to deal with the hazards of small utrs vis motif finder. (Add warning)
+ * Add warning about saving FASTA file.
+ * Add a general principles section near the top
+ * Using comparison algorithm which will pickup all repeats
+ * Add info about repeatmasking
+ * Checking upstream and downstream genes for make sure you are in the right regions.
+ * Later on: look into Ensembl
+ * Look into method of homology instead of blating.
+ * Mention advantages of using mupa.
+ * Mention the difference between using arrows and scroll bar
+ * Document the color for motifs
+ * Update for Mac user left-click
-Last updated: May 18th, 2006
+ * Wormbase/Flybase/mirBASE tutorials
-Updated to Mussagl build: 141 (Update to 200 in progress)
.. contents::
+Status
+======
+
+Major New Features
+------------------
+
+ * Build 381
+ * Analysis "Save As" feature
+
+Change Log
+----------
+
+.. INSERT CHANGE LOG HERE
+.. END INSERT CHANGE LOG
+
+Features to be Implemented
+--------------------------
+
+ * Motif editor supporting more than 10 motifs
+ (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/122)
+ * Save motifs from Mussagl
+ (Status: http://woldlab.caltech.edu/cgi-bin/mussa/ticket/133)
+
+For an up-to-date list of features to be implemented visit:
+http://woldlab.caltech.edu/cgi-bin/mussa/roadmap
+
Introduction
============
What is Mussagl?
----------------
+Mussa is an N-way version of the FamilyRelations (which is a part of
+the Cartwheel project) 2-way comparative sequence analysis
+software. Given DNA sequence from N species, Mussa uses all possible
+pairwise comparions to derive an N-wise comparison. For example, given
+sequences 1,2,3, and 4, Mussa makes 6 2-way comparisons: 1vs2, 1vs3,
+1vs4, 2vs3, 2vs4, and 3vs4. It then compares all the links between
+these comparisons, saving those that satisfy a transitivity
+requirement. The saved paths are then displayed in an interactive
+viewer.
Short History of Mussa
----------------------
-
Mussa Python/PMW Prototype
~~~~~~~~~~~~~~~~~~~~~~~~~~
+First Python/PMW based protoype.
Mussa C++/FLTK
~~~~~~~~~~~~~~
+A rewrite for speed purposes using C++ and FLTK GUI toolkit.
Mussagl C++/Qt/OpenGL
~~~~~~~~~~~~~~~~~~~~~
+Refactored version using the more elegant Qt GUI framework and
+OpenGL for hardware acceleration for those who have better graphics
+cards.
Getting Mussagl
===============
Mac OS X
~~~~~~~~
-Once you have downloaded the .dmg file, dubble click on it and follow
+Once you have downloaded the .dmg file, double click on it and follow
the install instructions.
FIXME: Mention how to launch the program.
Once you have downloaded the Mussagl installer, double click on the
installer and follow the install instructions.
-To start mussagl, launch the program from Start > Programs > Mussagl >
-Mussgl.
+To start Mussagl, launch the program from Start > Programs > Mussagl >
+Mussagl.
Linux
__ wiki_
+Obtaining Input Data
+====================
+
+If you already have your data, you can skip ahead to the the `Using
+Mussagl`_ section.
+
+Let's say you have a gene of interest called 'SMN1' and you want to
+know how the sequence surrounding the gene in multiple species is
+conserved. Guess what, that's what we are going to do, retrieve the
+DNA sequence for SMN1 and prepare it for using in Mussa.
+
+For more information about SMN1 visit `NCBI's OMIM
+<http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=609682>`_.
+
+UCSC Genome Browser Method
+--------------------------
+
+There are many methods of retrieving DNA sequence, but for this
+example we will retrieve SMN1 through the UCSC genome browser located
+at http://genome.ucsc.edu/.
+
+.. image:: images/ucsc_genome_browser_home.png
+ :alt: UCSC Genome Browser
+ :align: center
+
+Step 1 - Find SMN1
+~~~~~~~~~~~~~~~~~~
+
+The first step in finding SMN1 is to use the **Gene Sorter** menu
+option which I have highlighted in orange below:
+
+.. image:: images/ucsc_menu_bar_gene_sorter.png
+ :alt: Gene Sorter Menu Option
+ :align: center
+
+Gene Sorter page:
+
+.. image:: images/ucsc_gene_sorter.png
+ :alt: Gene Sorter
+ :align: center
+
+We will start by looking for SMN1 in the **Human Genome** and **sorting by name similarity**.
+
+.. image:: images/ucsc_gs_sort_name_sim.png
+ :alt: Gene Sorter - Name Similarity
+ :align: center
+
+After you have selected **Human Genome** and **sorting by name similarity**, type *SMN1* into the search box.
+
+.. image:: images/ucsc_gs_smn1.png
+ :alt: Gene
+ :align: center
+
+Press **Go!** and you should see the following page:
+
+.. image:: images/ucsc_gs_found.png
+ :alt: Found SMN1
+ :align: center
+
+Click on **SMN1** and you will be taking the gene expression atlas
+page.
+
+.. image:: images/ucsc_gs_genome_position.png
+ :alt: Gene expression atlas
+ :align: center
+
+Click on **chr5 70,270,558** found in the **SMN1 row**, **Genome
+position column**.
+
+Now we have found the location of SMN1 on human!
+
+.. image:: images/ucsc_gb_smn1_human.png
+ :alt: Genome Browser - SMN1 (human)
+ :align: center
+
+
+Step 2 - Download CDS/UTR sequence for annotations
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+Since we have found **SMN1**, this would be a convenient time to extract
+the DNA sequence for the CDS and UTRs of the gene to use it as an
+annotation_ in Mussa.
+
+**Click on SMN1** shown **between** the **two orange arrows** shown
+below.
+
+.. image:: images/ucsc_gb_smn1_human_click_smn1.png
+ :alt: Genome Browser - SMN1 (human) - Orange Arrows
+ :align: center
+
+You should find yourself at the SMN1 description page.
+
+.. image:: images/ucsc_gb_smn1_description_page.png
+ :alt: Genome Browser - SMN1 (human) - Description page
+ :align: center
+
+**Scroll down** until you get to the **Sequence section** and click on
+**Genomic (chr5:70,256,524-70,284,592)**.
+
+.. image:: images/ucsc_gb_smn1_human_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Sequence
+ :align: center
+
+You should now be at the **Genomic sequence near gene** page:
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Get genomic sequence
+ :align: center
+
+Make the following changes (highlighted in orange in the screenshot
+below):
+
+ 1. UNcheck **introns**.
+ (We only want to annotate CDS and UTRs.)
+ 2. Select **one FASTA record** per **region**.
+ (Mussa needs each CDS and UTR represented by one FASTA record per CDS/UTR).
+ 3. Select **CDS in upper case, UTR in lower case.**
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_diff.png
+ :alt: Genome Browser - SMN1 (human) - Get genomic sequence setup
+ :align: center
+
+Now click the **submit** button. You will then see a FASTA file with
+many FASTA records representing the CDS and UTRS.
+
+.. image:: images/ucsc_gb_smn1_human_get_genomic_sequence_submit.png
+ :alt: Genome Browser - SMN1 (human) - CDS/UTR sequence
+ :align: center
+
+Now you need to save the FASTA records to a **text file**. If you are
+using **Firefox** or **Internet Explorer 6+** click on the **File >
+Save As** menu option.
+
+**IMPORTANT:** Make sure you select **Text Files** and **NOT**, I
+repeat **NOT Webpage Complete** (see screenshot below.)
+
+Type in **smn1_human_annot.txt** for the file name.
+
+.. image:: images/smn1_human_annot.png
+ :alt: Genome Browser - SMN1 (human) - sequence annotation file
+ :align: center
+
+**IMPORTANT:** You should open the file with a text editor and make
+ sure **no HTML** was saved... If you find any HTML markup, delete
+ the markup and save the file.
+
+Now we are going to **modify the file** you just saved to **add the
+name of the species** to the **annotation file**. All you have to do
+is **add a new line** at the **top of the file** with the word **'Human'** as
+shown below:
+
+.. image:: images/smn1_human_annot_plus_human.png
+ :alt: Genome Browser - SMN1 (human) - sequence annotation file
+ :align: center
+
+You can add more annotations to this file if you wish. See the
+`annotation file format`_ section for details of the file format. By
+including FASTA records in the annotation_ file, Mussa searches your
+DNA sequence for an exact match of the sequence in the annotation_
+file. If found, it will be marked as an annotation_ within Mussa.
+
+
+Step 3 - Download gene and upstream/downstream sequence
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+Use the back button in your web browser to get back the **genome
+browser view** of **SMN1** as shown below.
+
+.. image:: images/ucsc_gb_smn1_human.png
+ :alt: Genome Browser - SMN1 (human)
+ :align: center
+
+There are two options for getting additional sequence around your
+gene. The more complex way is to zoom out so that you have the
+sequence you want being shown in the genome browser and then follow
+the directions for the following method.
+
+The second option, which we will choose, is to leave the genome
+browser zoomed exactly at the location of SMN1 and click on the
+**DNA** option on the menu bar (shown with orange arrows in the
+screenshot below.)
+
+.. image:: images/ucsc_gb_smn1_human_dna_option.png
+ :alt: Genome Browser - SMN1 (human) - DNA Option
+ :align: center
+
+Now in the **get dna in window** page, let's add an arbitrary amount of
+extra sequence on to each end of the gene, let's say 5000 base pairs.
+
+.. image:: images/ucsc_gb_smn1_human_get_dna.png
+ :alt: Genome Browser - SMN1 (human) - Get DNA
+ :align: center
+
+Click the **get DNA** button.
+
+.. image:: images/ucsc_gb_smn1_human_dna.png
+ :alt: Genome Browser - SMN1 (human) - DNA
+ :align: center
+
+Save the DNA sequence to a text file called 'smn1_human_dna.fa' as we
+did in step 2 with the annotation file.
+
+**IMPORTANT:** Make sure the file is saved as a text file and not an
+HTML file. Open the file with a text editor and remove any HTML markup
+you find.
+
+
+Step 4 - Same/similar/related gene other species.
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+
+What good is a multiple sequence alignment viewer without multiple
+sequences? Let'S find a similar gene in a few more species.
+
+Use the back button on your web browser until you get the **genome
+browser view** of **SMN1** as shown below.
+
+.. image:: images/ucsc_genome_browser_home.png
+ :alt: UCSC Genome Browser
+ :align: center
+
+**Click on SMN1** shown **between** the **two orange arrows** shown
+below.
+
+.. image:: images/ucsc_gb_smn1_human_click_smn1.png
+ :alt: Genome Browser - SMN1 (human) - Orange Arrows
+ :align: center
+
+You should find yourself at the SMN1 description page.
+
+.. image:: images/ucsc_gb_smn1_description_page.png
+ :alt: Genome Browser - SMN1 (human) - Description page
+ :align: center
+
+**Scroll down** until you get to the **Sequence section** and click on
+**Protein (262 aa)**.
+
+.. image:: images/ucsc_gb_smn1_human_sequence.png
+ :alt: Genome Browser - SMN1 (human) - Sequence
+ :align: center
+
+Copy the SMN1 protein seqeunce by highlighting it and selecting **Edit
+> Copy** option from the menu.
+
+.. image:: images/smn1_human_protein.png
+ :alt: Genome Browser - SMN1 (human) - Protein
+ :align: center
+
+Press the back button on the web browser once and then scroll to the
+top of the page and click on the **BLAT** option on the menu bar
+(shown below with orange arrows).
+
+.. image:: images/ucsc_gb_smn1_human_blat.png
+ :alt: Genome Browser - SMN1 (human) - Blat
+ :align: center
+
+**Paste** in the **protein sequence** and **change** the **genome** to
+**mouse** as shown below and then click **submit**.
+
+.. image:: images/ucsc_gb_smn1_human_blat_paste.png
+ :alt: Genome Browser - SMN1 (human) - Blat paste protein
+ :align: center
+
+Notice that we have two hits, one of which looks pretty good at 89.9%
+match.
+
+.. image:: images/ucsc_gb_smn1_human_blat_hits.png
+ :alt: Genome Browser - SMN1 (human) - Blat hits
+ :align: center
+
+**Click** on the **brower** link next to the 89.9% match. Notice in
+the genome browser (shown below) that there is an annotated gene
+called SMN1 for mouse which matches the line called **your sequence
+from blat search**. This means we are fairly confidant we found the
+right location in the mouse genome.
+
+.. image:: images/ucsc_gb_smn1_human_blat_to_browser.png
+ :alt: Genome Browser - SMN1 (human) - Blat to browser
+ :align: center
+
+Follow steps 1 through 3 for mouse and then repeat step 4 with the
+human protein sequence to find **SMN1** in the following species (if
+you find a match):
+
+ 1. Rat
+ 2. Rabbit
+ 3. Dog
+ 4. Armadillo
+ 5. Elephant
+ 6. Opposum
+ 7. x_tropicalis
+
+Make sure to save the extended DNA sequence and annotation file for
+each one.
+
Using Mussagl
=============
Create/Load Analysis
----------------------
-Currently there are three ways to load a mussa experiment.
+Currently there are three ways to load a Mussa experiment.
1. `Create a new analysis`_
2. `Load a mussa parameter file`_ (.mupa)
Instructions:
- 1. **Give the experiement a name**, for this demo, we'll use
+ 1. **Give the experiment a name**, for this demo, we'll use
'demo_w30_t20'. Mussa will create a folder with this name to store
the analysis files in once it has been run.
then select /examples/seq/human_mck_pro.fa file. Do the same in the
next two sequence input boxes selecting mouse_mck_pro.fa and
rabbit_mck_pro.fa as shown below. Note that you can create annotation
-files using the mussa `Annotation File Format` to add annotations to
+files using the mussa `Annotation File Format`_ to add annotations to
your sequence.
.. image:: images/define_analysis_step2.png
parameter file. See the `Parameter File Format`_ section for details
on creating a .mupa file.
-Once you have a .mupa file created, load Mussgl and select the **File >
+Once you have a .mupa file created, load Mussagl and select the **File >
Load Mussa Parameters** menu option. Select the .mupa file and click
open.
Overview
~~~~~~~~
-.. Screenshot with numbers showing features.
+.. Screen-shot with numbers showing features.
.. image:: images/window_overview.png
:alt: Mussa Window
:align: center
Each of the black bars represents one of the loaded sequences, in this
-case the sequence around the gene 'MCK' in human, mouse, and rabit.
+case the sequence around the gene 'MCK' in human, mouse, and rabbit.
FIXME: Should I mention the repeats here?
Annotations can be included on any of the sequences using the `Load a
mussa parameter file`_ method of loading your sequences. You can
-define annotations by location or using an exact subsequence and you
-may also choose any color for display of the annoation; see the
+define annotations by location or using an exact sub-sequence and you
+may also choose any color for display of the annotation; see the
`Annotation File Format`_ section for details.
Note: Currently there is no way to add annotations using the GUI (only
Motif shown in light blue on sequence bar.
-The only real difference between an annotation and motif in mussagl is
+The only real difference between an annotation and motif in Mussagl is
that you can define motifs from within the GUI. See the `Motifs`_
section for more information.
:alt: Dynamic Threshold
:align: center
-You can dynamically change the threshold for how strong of match you
+You can dynamically change the threshold for how strong a match you
consider the conservation to be with one of two options:
- 1. Number of base pair matchs out of window size.
+ 1. Number of base pair matches out of window size.
2. Percent base pair conservation.
-See the Threshold_ section for more infromation.
+See the Threshold_ section for more information.
Sequence Information Bar
:alt: Sequence Information Bar
:align: center
-The sequence infomation bars can be found to the left and right sides
-of mussagl. Next to each sequence you will find the following
+The sequence information bars can be found to the left and right sides
+of Mussagl. Next to each sequence you will find the following
information:
1. Species (If it has been defined)
Motif Dialog
************
+**New Features:**
+
+Build 276
+ * Allow for toggling individual motifs on and off.
+
+Build 269
+ * Field added for naming motifs.
+
Mussa has the ability to find lab motifs using the `IUPAC Nucleotide
-Code`_ for defining a motif. To define a motif, select **View > Edit
+Code`_ for defining a motif. To define a motif, select **Edit > Edit
Motifs** menu item as shown below.
.. image:: images/view_edit_motifs.png
You will see a dialog box appear with a "set motifs" button and 10
rows for defining motifs and the color that will be displayed on the
-sequence. By default all 10 motifs start off as with white as the color.
+sequence. By default all 10 motifs start off as with white as the
+color. In the image below, I changed the color from white to blue to
+make it easier to see. The first text box is for the motif and the
+second box is for the name of the motif. The check box defines whether
+the motif is displayed or not.
.. image:: images/motif_dialog_start.png
:alt: Motif Dialog
:align: center
+Now let's make a motif **'AT[C or G]CT'**. Using the `IUPAC Nucleotide
+Code`_, type in **'ATSCT'** into the first box and 'My Motif' for the
+name in the second box as shown below.
+
+.. image:: images/motif_dialog_enter_motif.png
+ :alt: Enter Motif
+ :align: center
+
+Now choose a color for your motif by clicking on the colored area to
+the left of the motif. In the image above, you would click on the blue
+square, but by default the squares will be white. Remember to choose a
+color that will show up well with a black bar as the background.
+
+.. image:: images/color_chooser.png
+ :alt: Color Chooser
+ :align: center
+
+Once you have selected the color for your motif, click on the 'set
+motifs' button. Notice that if Mussa finds matches to your motif will
+now show up in the main Mussagl window.
+
+Before Motif:
+
+.. image:: images/motif_dialog_bar_before.png
+ :alt: Sequence bar before motif
+ :align: center
+
+After Motif:
+
+.. image:: images/motif_dialog_bar_after.png
+ :alt: Sequence bar after motif
+ :align: center
+
+
+View Mussa Alignments
+---------------------
+
+Mussagl allows you to zoom in on Mussa alignments by selecting the set
+of alignment(s) of interest. To do this, move the mouse near the
+alignment you are interested in viewing and then **PRESS** and
+**HOLD** the **LEFT mouse button** and **drag the mouse** to the other
+side of the conservation track so that you see a bounding box
+overlaping the alienment(s) of interest and then **let go** of the
+*left mouse button*.
+
+In the example below, I started by left-clicking on the area marked by
+a red dot (upper left corner of bounding box) and dragging the mouse to
+the area marked by a blue dot (lower right corner of the bounding box)
+and letting go of the left mouse button.
+
+.. image:: images/select_sequence.png
+ :alt: Select Sequence
+ :align: center
+
+All of the lines which were not selected should be washed out as shown
+below:
+
+.. image:: images/washed_out.png
+ :alt: Tracks washed out
+ :align: center
+
+With a selection made, goto the **View** menu and select **View mussa alignment**.
+
+.. image:: images/view_mussa_alignment.png
+ :alt: View mussa alignment
+ :align: center
+
+You should see the alignment at the base-pair level as shown below.
+
+.. image:: images/mussa_alignment.png
+ :alt: Mussa alignment
+ :align: center
+
-Detailed Info
--------------
+Sub-analysis
+------------
+
+To run a sub-analysis **highlight** a section of sequence and *right
+click* on it and select **Add to subanalysis**. To the same for the
+sequences shown in orange in the screenshot below. Note that you **are
+NOT limited** to selecting more than one subsequence from the same
+sequence.
+
+.. image:: images/subanalysis_select_seqs.png
+ :alt: Subanalysis sequence selection
+ :align: center
+
+Once you have added your sequences for subanalysis, choose a `window size`_ and `threshold`_ and click **Ok**.
+
+.. image:: images/subanalysis_dialog.png
+ :alt: Subanalysis Dialog
+ :align: center
+
+A new Mussa window will appear with the subanalysis of your sequences
+once it's done running. This may take a while if you selected large
+chunks of sequence with a loose threshold.
+
+.. image:: images/subanalysis_done.png
+ :alt: Subalaysis complete
+ :align: center
+
+
+Copying sequence to clipboard
+-----------------------------
+
+To copy a sequence to the clipboard, highlight a section of sequence,
+as shown in the screen shot below, and do one of the following:
+
+ * Select **Copy as FASTA** from the **Edit** menu.
+ * **Right-Click (Left-click + Apple/Command Key on Mac)** on the highlighted sequence and select **Copy as FASTA**.
+ * Press **Ctrl + C (on PC)** or **Apple/Command Key + C (on Mac)** on the keyboard.
+
+.. image:: images/copy_sequence.png
+ :alt: Copy sequence
+ :align: center
+
+Saving to an Image
+---------------------------------
+
+FIXME: Need to write this section
+
+
+Detailed Information
+--------------------
Threshold
~~~~~~~~~
Sequences
~~~~~~~~~
-Mussa reads in sequences which are formated in the fasta_
+Mussa reads in sequences which are formatted in the FASTA_
format. Mussa may take a long time to run (>10 minutes) if the total
bp length near 280Kb. Once mussa has run once, you can reload
-previously run analyses.
+previously run analyzes.
FIXME: We have learned more about how much sequence and how many to
-put in mussagl, this information should be documented here.
+put in Mussagl, this information should be documented here.
Mussa File Formats
::
- # name of anaylsis directory and stem for associated files
+ # name of analysis directory and stem for associated files
ANA_NAME <analysis_name>
# if APPEND vars true, a _wXX and/or _tYY added to analysis name
SEQUENCE_NUM <num>
# first sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
ANNOTATION <annotation_file_path>
SEQ_START <sequence_start>
# the second sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
# ANNOTATION <annotation_file_path>
SEQ_START <sequence_start>
# SEQ_END <sequence_end>
# third sequence info
- SEQUENCE <fasta_file_path>
+ SEQUENCE <FASTA_file_path>
# ANNOTATION <annotation_file_path>
- # analyses parameters: command line args -w -t will override these
+ # analyzes parameters: command line args -w -t will override these
WINDOW <num>
THRESHOLD <num>
"APPEND_WIN", "true/false", "?", "?", "Appends _w## to ANA_NAME"
"APPEND_THRES", "true or false", "?", "?", "Appends _t## to ANA_NAME"
"SEQUENCE_NUM", "integer", "N/A", "true", "The number of sequences
- to analyse"
- "SEQUENCE", "/fasta/filepath.fa", "N/A", "true", "Must define one
+ to analyze"
+ "SEQUENCE", "/FASTA/filepath.fa", "N/A", "true", "Must define one
sequence per SEQUENCE_NUM."
"ANNOTATION", "/annotation/filepath.txt", "N/A", "false", "Optional
annotation file. See `annotation file format`_ section for more
information."
- "SEQ_START", "integer", "1", "false", "Optional index into fasta file"
- "SEQ_END", "integer", "1", "false", "Optional index into fasta file"
+ "SEQ_START", "integer", "1", "false", "Optional index into FASTA file"
+ "SEQ_END", "integer", "1", "false", "Optional index into FASTA file"
"WINDOW", "integer", "N/A", "true", "`Window Size`_"
"THRESHOLD", "integer", "N/A", "true", "`Threshold`_"
~~~~~~~~~~~~~~~~~~~~~~
The first line in the file is the sequence name. Each line there after
-is a **space** seperated annotation.
+is a **space** separated annotation.
New as of build 198:
- * The annotation format now supports fasta sequences embeded in the
+ * The annotation format now supports FASTA sequences embedded in the
annotation file as shown in the format example below. Mussagl will
take this sequence and look for an exact match of this sequence in
your sequences. If a match is found, it will label it with the name
- of from the fasta header.
+ of from the FASTA header.
Format:
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
<start> <stop> <annotation_name> <annotation_type>
- >Fasta Header
+ >FASTA Header
ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
IUPAC Nucleotide Code
-~~~~~~~~~~~~~~~~~~~~~
+~~~~~~~~~~~~~~~~~~~~~~
-For your convience, below is a table of the IUPAC Nucleotide Code.
+For your convenience, below is a table of the IUPAC Nucleotide Code.
The following table is table 1 from "Nomenclature for Incompletely
Specified Bases in Nucleic Acid Sequences" which can be found at
.. _GPL: http://www.opensource.org/licenses/gpl-license.php
.. _wiki: http://mussa.caltech.edu
.. _build: http://woldlab.caltech.edu/cgi-bin/mussa/wiki/MussaglBuild
-.. _fasta: http://en.wikipedia.org/wiki/FASTA_format
-.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif
-
+.. _FASTA: http://en.wikipedia.org/wiki/fasta_format
+.. _wpDnaMotif: http://en.wikipedia.org/wiki/DNA_motif
\ No newline at end of file