Manual: Motif/Annotation documentation

diff --git a/doc/manual/mussagl_manual.rst b/doc/manual/mussagl_manual.rst
index ebf16d36a4be94c6beb344f215dca9e2d2d4c754..615160444f2e896929ec0aba52bdedd692dc7086 100644 (file)
--- a/doc/manual/mussagl_manual.rst
+++ b/doc/manual/mussagl_manual.rst
@@ -62,7 +62,8 @@ Supported Platforms:
 Download
 --------
 
-Mussagl can be downloaded from http://mussa.caltech.edu/.
+Mussagl in binary form for OS X and Windows and/or source can be
+downloaded from http://mussa.caltech.edu/.
 
 Install
 -------
@@ -157,7 +158,9 @@ Instructions:
 Now click on the 'Browse' button next to the sequence input box and
 then select /examples/seq/human_mck_pro.fa file. Do the same in the
 next two sequence input boxes selecting mouse_mck_pro.fa and
-rabbit_mck_pro.fa as shown below.
+rabbit_mck_pro.fa as shown below. Note that you can create annotation
+files using the mussa `Annotation File Format` to add annotations to
+your sequence.
 
 .. image:: images/define_analysis_step2.png
    :alt: Choose sequences
@@ -384,15 +387,40 @@ Annotations / Motifs
 Annotations
 ~~~~~~~~~~~
 
+Currently annotations can be added to a sequence using the mussa
+`annotation file format`_ and can be loaded by selecting the
+annotation file when defining a new analysis (see `Create a new
+analysis`_ section) or by defining a .mupa file pointing to your
+annotation file (see `Load a mussa parameter file`_ section).
+
 Motifs
 ~~~~~~
 
 Load Motifs from File
 *********************
 
+It is possible to load motifs from a file which was saved from a
+previous run or by defining your own motif file. See the `Motif File
+Format`_ section for details.
+
+To load a motif file, select **Load Motif List** item from the
+**File** menu and select a motif list file.
+
+.. image:: images/load_motif.png
+   :alt: Load Motif List
+   :align: center
+
+
+Save Motifs to File
+*******************
+
+Note: Currently not implemented
+
+
 Motif Dialog
 ************
 
+FIXME: Continue here.
 
 Detailed Info
 -------------
@@ -501,7 +529,15 @@ Annotation File Format
 ~~~~~~~~~~~~~~~~~~~~~~
 
 The first line in the file is the sequence name. Each line there after
-is a **space** seperated annotation.
+is a **space** seperated annotation. 
+
+New as of build 198:
+ 
+ * The annotation format now supports fasta sequences embeded in the
+   annotation file as shown in the format example below. Mussagl will
+   take this sequence and look for an exact match of this sequence in
+   your sequences. If a match is found, it will label it with the name 
+   of from the fasta header.
 
 Format:
 
@@ -512,6 +548,12 @@ Format:
   <start> <stop> <annotation_name> <annotation_type>
   <start> <stop> <annotation_name> <annotation_type>
   <start> <stop> <annotation_name> <annotation_type>
+  >Fasta Header
+  ACTGACTGACGTACGTAGCTAGCTAGCTAGCACG
+  ACGTACGTACGTACGTAGCTGTCATACGCTAGCA
+  TGCGTAGAGGATCTCGGATGCTAGCGCTATCGAT
+  ACGTACGGCAGTACGCGGTCAGA
+  <start> <stop> <annotation_name> <annotation_type>
   ...
 
 Example:
@@ -522,6 +564,8 @@ Example:
   251 500 Glorp Glorptype
   751 1000 Glorp Glorptype
   1251 1500 Glorp Glorptype
+  >My favorite DNA sequence
+  GATTACA
   1751 2000 Glorp Glorptype