import pysam
import unittest
-import os, re
-import itertools
+import os, re, sys
+import itertools, collections
import subprocess
import shutil
+import logging
+SAMTOOLS="samtools"
+WORKDIR="pysam_test_work"
def checkBinaryEqual( filename1, filename2 ):
'''return true if the two files are binary equal.'''
def getSamtoolsVersion():
'''return samtools version'''
- pipe = subprocess.Popen("samtools", shell=True, stderr=subprocess.PIPE).stderr
+ pipe = subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr
lines = "".join(pipe.readlines())
return re.search( "Version:\s+(\S+)", lines).groups()[0]
first_time = True
# a list of commands to test
- mCommands = \
- { "faidx" : \
- (
- ("ex1.fa.fai", "samtools faidx ex1.fa"),
- ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ),
- ),
- "import" :
+ commands = \
+ {
+ "view" :
(
- ("ex1.bam", "samtools import ex1.fa.fai ex1.sam.gz ex1.bam" ),
- ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ),
+ ("ex1.view", "view ex1.bam > ex1.view"),
+ ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ),
+ ),
+ "view2" :
+ (
+ ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"),
+ # note that -o ex1.view2 throws exception.
+ ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ),
+ ),
+ "sort" :
+ (
+ ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ),
+ ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ),
+ ),
+ "mpileup" :
+ (
+ ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ),
+ ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ),
+ ),
+ "depth" :
+ (
+ ("ex1.depth", "depth ex1.bam > ex1.depth" ),
+ ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ),
+ ),
+ "faidx" :
+ (
+ ("ex1.fa.fai", "faidx ex1.fa"),
+ ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ),
),
"index":
(
- ("ex1.bam.bai", "samtools index ex1.bam" ),
+ ("ex1.bam.bai", "index ex1.bam" ),
("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ),
),
- "pileup1" :
- (
- ("ex1.pileup", "samtools pileup -cf ex1.fa ex1.bam > ex1.pileup" ),
- ("pysam_ex1.pileup", (pysam.pileup, "-c -f ex1.fa ex1.bam" ) )
+ "idxstats" :
+ (
+ ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ),
+ ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ),
),
- "pileup2" :
- (
- ("ex1.glf", "samtools pileup -gf ex1.fa ex1.bam > ex1.glf" ),
- ("pysam_ex1.glf", (pysam.pileup, "-g -f ex1.fa ex1.bam" ) )
+ "fixmate" :
+ (
+ ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ),
+ ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ),
),
- "glfview" :
- (
- ("ex1.glfview", "samtools glfview ex1.glf > ex1.glfview"),
- ("pysam_ex1.glfview", (pysam.glfview, "ex1.glf" ) ),
+ "flagstat" :
+ (
+ ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ),
+ ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ),
),
- "view" :
- (
- ("ex1.view", "samtools view ex1.bam > ex1.view"),
- ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ),
+ "calmd" :
+ (
+ ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ),
+ ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ),
+ ),
+ "merge" :
+ (
+ ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ),
+ # -f option does not work - following command will cause the subsequent
+ # command to fail
+ ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ),
+ ),
+ "rmdup" :
+ (
+ ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ),
+ ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )),
+ ),
+ "reheader" :
+ (
+ ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"),
+ ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ),
+ ),
+ "cat":
+ (
+ ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"),
+ ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ),
+ ),
+ "targetcut":
+ (
+ ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ),
+ ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ),
+ ),
+ "phase":
+ (
+ ("ex1.phase", "phase ex1.bam > ex1.phase" ),
+ ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ),
+ ),
+ "import" :
+ (
+ ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ),
+ ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ),
+ ),
+ "bam2fq":
+ (
+ ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ),
+ ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ),
),
}
# some tests depend on others. The order specifies in which order
# the samtools commands are executed.
- mOrder = ('faidx', 'import', 'index', 'pileup1', 'pileup2', 'glfview', 'view' )
+ # The first three (faidx, import, index) need to be in that order,
+ # the rest is arbitrary.
+ order = ('faidx', 'import', 'index',
+ # 'pileup1', 'pileup2', deprecated
+ # 'glfview', deprecated
+ 'view', 'view2',
+ 'sort',
+ 'mpileup',
+ 'depth',
+ 'idxstats',
+ 'fixmate',
+ 'flagstat',
+ # 'calmd',
+ 'merge',
+ 'rmdup',
+ 'reheader',
+ 'cat',
+ 'targetcut',
+ 'phase',
+ 'bam2fq',
+ )
def setUp( self ):
'''setup tests.
files.
'''
if BinaryTest.first_time:
- # copy the source
- shutil.copy( "ex1.fa", "pysam_ex1.fa" )
- for label in self.mOrder:
- command = self.mCommands[label]
+ # remove previous files
+ if os.path.exists( WORKDIR ):
+ shutil.rmtree( WORKDIR )
+
+ # copy the source files to WORKDIR
+ os.makedirs( WORKDIR )
+
+ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) )
+ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) )
+ shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) )
+ shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) )
+
+ # cd to workdir
+ savedir = os.getcwd()
+ os.chdir( WORKDIR )
+
+ for label in self.order:
+ command = self.commands[label]
samtools_target, samtools_command = command[0]
- pysam_target, pysam_command = command[1]
- runSamtools( samtools_command )
+ try:
+ pysam_target, pysam_command = command[1]
+ except ValueError, msg:
+ raise ValueError( "error while setting up %s=%s: %s" %\
+ (label, command, msg) )
+ runSamtools( " ".join( (SAMTOOLS, samtools_command )))
pysam_method, pysam_options = pysam_command
- output = pysam_method( *pysam_options.split(" "), raw=True)
+ try:
+ output = pysam_method( *pysam_options.split(" "), raw=True)
+ except pysam.SamtoolsError, msg:
+ raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\
+ (label, pysam_options, msg) )
if ">" in samtools_command:
- outfile = open( pysam_target, "w" )
+ outfile = open( pysam_target, "wb" )
for line in output: outfile.write( line )
outfile.close()
-
+
+ os.chdir( savedir )
BinaryTest.first_time = False
+
+
samtools_version = getSamtoolsVersion()
- if samtools_version != pysam.__samtools_version__:
+
+
+ def _r( s ):
+ # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12
+ if s.count('-') > 0: s = s[0:s.find('-')]
+ return re.sub( "[^0-9.]", "", s )
+
+ if _r(samtools_version) != _r( pysam.__samtools_version__):
raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \
(pysam.__samtools_version__,
samtools_version ))
def checkCommand( self, command ):
-
if command:
- samtools_target, pysam_target = self.mCommands[command][0][0], self.mCommands[command][1][0]
+ samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0]
+ samtools_target = os.path.join( WORKDIR, samtools_target )
+ pysam_target = os.path.join( WORKDIR, pysam_target )
self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ),
"%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) )
def testIndex( self ):
self.checkCommand( "index" )
+
+ def testSort( self ):
+ self.checkCommand( "sort" )
+
+ def testMpileup( self ):
+ self.checkCommand( "mpileup" )
+
+ def testDepth( self ):
+ self.checkCommand( "depth" )
+
+ def testIdxstats( self ):
+ self.checkCommand( "idxstats" )
+
+ def testFixmate( self ):
+ self.checkCommand( "fixmate" )
+
+ def testFlagstat( self ):
+ self.checkCommand( "flagstat" )
- def testPileup1( self ):
- self.checkCommand( "pileup1" )
+ def testMerge( self ):
+ self.checkCommand( "merge" )
+
+ def testRmdup( self ):
+ self.checkCommand( "rmdup" )
+
+ def testReheader( self ):
+ self.checkCommand( "reheader" )
+
+ def testCat( self ):
+ self.checkCommand( "cat" )
+
+ def testTargetcut( self ):
+ self.checkCommand( "targetcut" )
+
+ def testPhase( self ):
+ self.checkCommand( "phase" )
+
+ def testBam2fq( self ):
+ self.checkCommand( "bam2fq" )
+
+ # def testPileup1( self ):
+ # self.checkCommand( "pileup1" )
- def testPileup2( self ):
- self.checkCommand( "pileup2" )
+ # def testPileup2( self ):
+ # self.checkCommand( "pileup2" )
- def testGLFView( self ):
- self.checkCommand( "glfview" )
+ # deprecated
+ # def testGLFView( self ):
+ # self.checkCommand( "glfview" )
def testView( self ):
self.checkCommand( "view" )
def testEmptyIndex( self ):
- self.assertRaises( pysam.SamtoolsError, pysam.index, "exdoesntexist.bam" )
+ self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" )
def __del__(self):
- return
- for label, command in self.mCommands.iteritems():
- samtools_target, samtools_command = command[0]
- pysam_target, pysam_command = command[1]
- if os.path.exists( samtools_target): os.remove( samtools_target )
- if os.path.exists( pysam_target): os.remove( pysam_target )
- if os.path.exists( "pysam_ex1.fa" ): os.remove( "pysam_ex1.fa" )
+ if os.path.exists( WORKDIR ):
+ shutil.rmtree( WORKDIR )
class IOTest(unittest.TestCase):
'''check if reading samfile and writing a samfile are consistent.'''
def checkEcho( self, input_filename, reference_filename,
output_filename,
- input_mode, output_mode, use_template = True):
+ input_mode, output_mode, use_template = True ):
'''iterate through *input_filename* writing to *output_filename* and
comparing the output to *reference_filename*.
The files are opened according to the *input_mode* and *output_mode*.
If *use_template* is set, the header is copied from infile using the
- template mechanism, otherwise target names and lengths are passed explicitely.
+ template mechanism, otherwise target names and lengths are passed
+ explicitely.
+
'''
infile = pysam.Samfile( input_filename, input_mode )
else:
outfile = pysam.Samfile( output_filename, output_mode,
referencenames = infile.references,
- referencelengths = infile.lengths )
+ referencelengths = infile.lengths,
+ add_sq_text = False )
iter = infile.fetch()
for x in iter: outfile.write( x )
self.checkEcho( input_filename, reference_filename, output_filename,
"r", "w" )
+ def testReadSamWithoutHeaderWriteSamWithoutHeader( self ):
+
+ input_filename = "ex1.sam"
+ output_filename = "pysam_ex1.sam"
+ reference_filename = "ex1.sam"
+
+ # disabled - reading from a samfile without header
+ # is not implemented.
+
+ # self.checkEcho( input_filename, reference_filename, output_filename,
+ # "r", "w" )
+
def testFetchFromClosedFile( self ):
samfile = pysam.Samfile( "ex1.bam", "rb" )
samfile.close()
self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
- def testPileupFromClosedFile( self ):
+ def testClosedFile( self ):
+ '''test that access to a closed samfile raises ValueError.'''
samfile = pysam.Samfile( "ex1.bam", "rb" )
samfile.close()
+ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120)
+ self.assertRaises( ValueError, samfile.getrname, 0 )
+ self.assertRaises( ValueError, samfile.tell )
+ self.assertRaises( ValueError, samfile.seek, 0 )
+ self.assertRaises( ValueError, getattr, samfile, "nreferences" )
+ self.assertRaises( ValueError, getattr, samfile, "references" )
+ self.assertRaises( ValueError, getattr, samfile, "lengths" )
+ self.assertRaises( ValueError, getattr, samfile, "text" )
+ self.assertRaises( ValueError, getattr, samfile, "header" )
+
+ # write on closed file
+ self.assertEqual( 0, samfile.write(None) )
+
+ def testAutoDetection( self ):
+ '''test if autodetection works.'''
+
+ samfile = pysam.Samfile( "ex3.sam" )
+ self.assertRaises( ValueError, samfile.fetch, 'chr1' )
+ samfile.close()
- def testBinaryReadFromSamfile( self ):
- pass
- # needs to re-activated, see issue 19
- #samfile = pysam.Samfile( "ex1.bam", "r" )
- #samfile.fetch().next()
+ samfile = pysam.Samfile( "ex3.bam" )
+ samfile.fetch('chr1')
+ samfile.close()
+
+ def testReadingFromSamFileWithoutHeader( self ):
+ '''read from samfile without header.
+ '''
+ samfile = pysam.Samfile( "ex7.sam" )
+ self.assertRaises( NotImplementedError, samfile.__iter__ )
def testReadingFromFileWithoutIndex( self ):
'''read from bam file without index.'''
self.assertRaises( ValueError, samfile.fetch )
self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 )
- def testReadingFromFileWithWrongMode( self ):
+ def testReadingUniversalFileMode( self ):
+ '''read from samfile without header.
+ '''
- assert not os.path.exists( "ex2.bam.bai" )
- samfile = pysam.Samfile( "ex2.bam", "r" )
- self.assertRaises( ValueError, samfile.fetch )
+ input_filename = "ex2.sam"
+ output_filename = "pysam_ex2.sam"
+ reference_filename = "ex1.sam"
+
+ self.checkEcho( input_filename, reference_filename, output_filename,
+ "rU", "w" )
+
+class TestFloatTagBug( unittest.TestCase ):
+ '''see issue 71'''
+
+ def testFloatTagBug( self ):
+ '''a float tag before another exposed a parsing bug in bam_aux_get - expected to fail
+
+ This test is expected to fail until samtools is fixed.
+ '''
+ samfile = pysam.Samfile("tag_bug.bam")
+ read = samfile.fetch(until_eof=True).next()
+ self.assertTrue( ('XC',1) in read.tags )
+ self.assertEqual(read.opt('XC'), 1)
+
+class TestTagParsing( unittest.TestCase ):
+ '''tests checking the accuracy of tag setting and retrieval.'''
+
+ def makeRead( self ):
+ a = pysam.AlignedRead()
+ a.qname = "read_12345"
+ a.tid = 0
+ a.seq="ACGT" * 3
+ a.flag = 0
+ a.rname = 0
+ a.pos = 1
+ a.mapq = 20
+ a.cigar = ( (0,10), (2,1), (0,25) )
+ a.mrnm = 0
+ a.mpos=200
+ a.isize = 0
+ a.qual ="1234" * 3
+ # todo: create tags
+ return a
+
+ def testNegativeIntegers( self ):
+ x = -2
+ aligned_read = self.makeRead()
+ aligned_read.tags = [("XD", int(x) ) ]
+ print aligned_read.tags
+
+ def testNegativeIntegers2( self ):
+ x = -2
+ r = self.makeRead()
+ r.tags = [("XD", int(x) ) ]
+ outfile = pysam.Samfile( "test.bam",
+ "wb",
+ referencenames = ("chr1",),
+ referencelengths = (1000,) )
+ outfile.write (r )
+ outfile.close()
class TestIteratorRow(unittest.TestCase):
def checkRange( self, rnge ):
'''compare results from iterator with those from samtools.'''
ps = list(self.samfile.fetch(region=rnge))
- sa = list(pysam.view( "ex1.bam", rnge , raw = True) )
+ sa = list(pysam.view( "ex1.bam", rnge, raw = True) )
self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) ))
# check if the same reads are returned and in the same order
for line, pair in enumerate( zip( ps, sa ) ):
- data = pair[1].split("\t")
- self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) )
+ a,b = pair
+ d = b.split("\t")
+ self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) )
+ self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \
+ (line, a.pos, int(d[3])-1,
+ str(a), str(d) ) )
+ self.assertEqual( a.qual, d[10], "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \
+ (line, a.qual, d[10],
+ str(a), str(d) ) )
def testIteratePerContig(self):
'''check random access per contig'''
def tearDown(self):
self.samfile.close()
-
class TestIteratorRowAll(unittest.TestCase):
def setUp(self):
# one read, all columns of the read are returned
self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\
(pos, len(columns), refcolumns))
+
+
def tearDown(self):
self.samfile.close()
def testARmrnm(self):
self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) )
self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) )
+ self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) )
+ self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) )
def testARmpos(self):
self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) )
self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) )
+ self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) )
+ self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) )
def testARisize(self):
self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) )
self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) )
+ self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) )
+ self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) )
def testARseq(self):
self.assertEqual( self.reads[0].seq, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, "AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
def testHeaders(self):
self.compareHeaders( self.header, self.samfile.header )
self.compareHeaders( self.samfile.header, self.header )
-
+
+ def testNameMapping( self ):
+ for x, y in enumerate( ("chr1", "chr2")):
+ tid = self.samfile.gettid( y )
+ ref = self.samfile.getrname( x )
+ self.assertEqual( tid, x )
+ self.assertEqual( ref, y )
+
+ self.assertEqual( self.samfile.gettid("chr?"), -1 )
+ self.assertRaises( ValueError, self.samfile.getrname, 2 )
+
def tearDown(self):
self.samfile.close()
self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 )
self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 )
+ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 )
+ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 )
+ self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 )
+
def testOutOfRangeNegativeOldFormat(self):
self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" )
self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" )
self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" )
+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" )
+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" )
+ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" )
+
def testOutOfRangNewFormat(self):
self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 )
+ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 )
def testOutOfRangeLargeNewFormat(self):
self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
+ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
def testOutOfRangeLargeOldFormat(self):
self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" )
+ self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" )
+
+ def testZeroToZero(self):
+ '''see issue 44'''
+ self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0)
def tearDown(self):
self.samfile.close()
+class TestWrongFormat(unittest.TestCase):
+ '''test cases for opening files not in bam/sam format.'''
+
+ def testOpenSamAsBam( self ):
+ self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' )
+
+ def testOpenBamAsSam( self ):
+ # test fails, needs to be implemented.
+ # sam.fetch() fails on reading, not on opening
+ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' )
+ pass
+
+ def testOpenFastaAsSam( self ):
+ # test fails, needs to be implemented.
+ # sam.fetch() fails on reading, not on opening
+ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' )
+ pass
+
+ def testOpenFastaAsBam( self ):
+ self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' )
+
class TestFastaFile(unittest.TestCase):
mSequences = { 'chr1' :
# unknown sequence returns ""
self.assertEqual( "", self.file.fetch("chr12") )
+ def testOutOfRangeAccess( self ):
+ '''test out of range access.'''
+ # out of range access returns an empty string
+ for contig, s in self.mSequences.iteritems():
+ self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), "" )
+
+ self.assertEqual( self.file.fetch( "chr3", 0 , 100), "" )
+
def testFetchErrors( self ):
self.assertRaises( ValueError, self.file.fetch )
self.assertRaises( ValueError, self.file.fetch, "chr1", -1, 10 )
self.assertEqual( a.rname, 0 )
self.assertEqual( a.mapq, 0 )
self.assertEqual( a.cigar, None )
- self.assertEqual( a.tags, None )
+ self.assertEqual( a.tags, [] )
self.assertEqual( a.mrnm, 0 )
self.assertEqual( a.mpos, 0 )
self.assertEqual( a.isize, 0 )
a.mpos=200
a.isize=167
a.qual="1234" * 3
-
+ # todo: create tags
return a
def testUpdate( self ):
return a
+ def testTagParsing( self ):
+ '''test for tag parsing
+
+ see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a
+ '''
+ samfile=pysam.Samfile( "ex8.bam","rb" )
+
+ for entry in samfile:
+ before = entry.tags
+ entry.tags = entry.tags
+ after = entry.tags
+ self.assertEqual( after, before )
+
class TestDeNovoConstruction(unittest.TestCase):
'''check BAM/SAM file construction using ex3.sam
os.unlink( tmpfilename )
+
class TestDoubleFetch(unittest.TestCase):
'''check if two iterators on the same bamfile are independent.'''
region = "1:1-1000"
def testFTPView( self ):
+ return
result = pysam.view( self.url, self.region )
self.assertEqual( len(result), 36 )
def testFTPFetch( self ):
+ return
samfile = pysam.Samfile(self.url, "rb")
result = list(samfile.fetch( region = self.region ))
self.assertEqual( len(result), 36 )
local = "ex1.bam"
def testView( self ):
- self.assertRaises( pysam.SamtoolsError, pysam.view, self.url, self.region )
+ samfile_local = pysam.Samfile(self.local, "rb")
+ ref = list(samfile_local.fetch( region = self.region ))
+
+ result = pysam.view( self.url, self.region )
+ self.assertEqual( len(result), len(ref) )
def testFetch( self ):
samfile = pysam.Samfile(self.url, "rb")
for x, y in zip(result, ref):
self.assertEqual( x.compare( y ), 0 )
+class TestLargeOptValues( unittest.TestCase ):
+
+ ints = ( 65536, 214748, 2147484, 2147483647 )
+ floats = ( 65536.0, 214748.0, 2147484.0 )
+
+ def check( self, samfile ):
+
+ i = samfile.fetch()
+ for exp in self.ints:
+ rr = i.next()
+ obs = rr.opt("ZP")
+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
+
+ for exp in [ -x for x in self.ints ]:
+ rr = i.next()
+ obs = rr.opt("ZP")
+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
+
+ for exp in self.floats:
+ rr = i.next()
+ obs = rr.opt("ZP")
+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
+
+ for exp in [ -x for x in self.floats ]:
+ rr = i.next()
+ obs = rr.opt("ZP")
+ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
+
+ def testSAM( self ):
+ samfile = pysam.Samfile("ex10.sam", "r")
+ self.check( samfile )
+
+ def testBAM( self ):
+ samfile = pysam.Samfile("ex10.bam", "rb")
+ self.check( samfile )
+
+# class TestSNPCalls( unittest.TestCase ):
+# '''test pysam SNP calling ability.'''
+
+# def checkEqual( self, a, b ):
+# for x in ("reference_base",
+# "pos",
+# "genotype",
+# "consensus_quality",
+# "snp_quality",
+# "mapping_quality",
+# "coverage" ):
+# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
+# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
+
+# def testAllPositionsViaIterator( self ):
+# samfile = pysam.Samfile( "ex1.bam", "rb")
+# fastafile = pysam.Fastafile( "ex1.fa" )
+# try:
+# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"]
+# except pysam.SamtoolsError:
+# pass
+
+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
+# calls = list(pysam.IteratorSNPCalls(i))
+# for x,y in zip( refs, calls ):
+# self.checkEqual( x, y )
+
+# def testPerPositionViaIterator( self ):
+# # test pileup for each position. This is a slow operation
+# # so this test is disabled
+# return
+# samfile = pysam.Samfile( "ex1.bam", "rb")
+# fastafile = pysam.Fastafile( "ex1.fa" )
+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
+# if x.reference_base == "*": continue
+# i = samfile.pileup( x.chromosome, x.pos, x.pos+1,
+# fastafile = fastafile,
+# stepper = "samtools" )
+# z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ]
+# self.assertEqual( len(z), 1 )
+# self.checkEqual( x, z[0] )
+
+# def testPerPositionViaCaller( self ):
+# # test pileup for each position. This is a fast operation
+# samfile = pysam.Samfile( "ex1.bam", "rb")
+# fastafile = pysam.Fastafile( "ex1.fa" )
+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
+# caller = pysam.SNPCaller( i )
+
+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
+# if x.reference_base == "*": continue
+# call = caller.call( x.chromosome, x.pos )
+# self.checkEqual( x, call )
+
+# class TestIndelCalls( unittest.TestCase ):
+# '''test pysam indel calling.'''
+
+# def checkEqual( self, a, b ):
+
+# for x in ("pos",
+# "genotype",
+# "consensus_quality",
+# "snp_quality",
+# "mapping_quality",
+# "coverage",
+# "first_allele",
+# "second_allele",
+# "reads_first",
+# "reads_second",
+# "reads_diff"):
+# if b.genotype == "*/*" and x == "second_allele":
+# # ignore test for second allele (positions chr2:439 and chr2:1512)
+# continue
+# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" %
+# (x, getattr(a, x), getattr(b,x), str(a), str(b)))
+
+# def testAllPositionsViaIterator( self ):
+
+# samfile = pysam.Samfile( "ex1.bam", "rb")
+# fastafile = pysam.Fastafile( "ex1.fa" )
+# try:
+# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"]
+# except pysam.SamtoolsError:
+# pass
+
+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
+# calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ]
+# for x,y in zip( refs, calls ):
+# self.checkEqual( x, y )
+
+# def testPerPositionViaCaller( self ):
+# # test pileup for each position. This is a fast operation
+# samfile = pysam.Samfile( "ex1.bam", "rb")
+# fastafile = pysam.Fastafile( "ex1.fa" )
+# i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
+# caller = pysam.IndelCaller( i )
+
+# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
+# if x.reference_base != "*": continue
+# call = caller.call( x.chromosome, x.pos )
+# self.checkEqual( x, call )
+
+class TestLogging( unittest.TestCase ):
+ '''test around bug issue 42,
+
+ failed in versions < 0.4
+ '''
+
+ def check( self, bamfile, log ):
+
+ if log:
+ logger = logging.getLogger('franklin')
+ logger.setLevel(logging.INFO)
+ formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s')
+ log_hand = logging.FileHandler('log.txt')
+ log_hand.setFormatter(formatter)
+ logger.addHandler(log_hand)
+
+ bam = pysam.Samfile(bamfile, 'rb')
+ cols = bam.pileup()
+ self.assert_( True )
+ def testFail1( self ):
+ self.check( "ex9_fail.bam", False )
+ self.check( "ex9_fail.bam", True )
+
+ def testNoFail1( self ):
+ self.check( "ex9_nofail.bam", False )
+ self.check( "ex9_nofail.bam", True )
+
+ def testNoFail2( self ):
+ self.check( "ex9_nofail.bam", True )
+ self.check( "ex9_nofail.bam", True )
+
# TODOS
# 1. finish testing all properties within pileup objects
# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...)
+# 3. check: presence of sequence
+
+class TestSamfileUtilityFunctions( unittest.TestCase ):
+
+ def testCount( self ):
+
+ samfile = pysam.Samfile( "ex1.bam", "rb" )
+
+ for contig in ("chr1", "chr2" ):
+ for start in xrange( 0, 2000, 100 ):
+ end = start + 1
+ self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ),
+ samfile.count( contig, start, end ) )
+
+ # test empty intervals
+ self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ),
+ samfile.count( contig, start, start ) )
+
+ # test half empty intervals
+ self.assertEqual( len( list( samfile.fetch( contig, start ) ) ),
+ samfile.count( contig, start ) )
+
+ def testMate( self ):
+ '''test mate access.'''
+
+ readnames = [ x.split("\t")[0] for x in open( "ex1.sam", "rb" ).readlines() ]
+ counts = collections.defaultdict( int )
+ for x in readnames: counts[x] += 1
+
+ samfile = pysam.Samfile( "ex1.bam", "rb" )
+ for read in samfile.fetch():
+ if not read.is_paired:
+ self.assertRaises( ValueError, samfile.mate, read )
+ elif read.mate_is_unmapped:
+ self.assertRaises( ValueError, samfile.mate, read )
+ else:
+ if counts[read.qname] == 1:
+ self.assertRaises( ValueError, samfile.mate, read )
+ else:
+ mate = samfile.mate( read )
+ self.assertEqual( read.qname, mate.qname )
+ self.assertEqual( read.is_read1, mate.is_read2 )
+ self.assertEqual( read.is_read2, mate.is_read1 )
+ self.assertEqual( read.pos, mate.mpos )
+ self.assertEqual( read.mpos, mate.pos )
+
+ def testIndexStats( self ):
+ '''test if total number of mapped/unmapped reads is correct.'''
+
+ samfile = pysam.Samfile( "ex1.bam", "rb" )
+ self.assertEqual( samfile.mapped, 3235 )
+ self.assertEqual( samfile.unmapped, 35 )
+
+class TestSamtoolsProxy( unittest.TestCase ):
+ '''tests for sanity checking access to samtools functions.'''
+
+ def testIndex( self ):
+ self.assertRaises( IOError, pysam.index, "missing_file" )
+
+ def testView( self ):
+ # note that view still echos "open: No such file or directory"
+ self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" )
+
+ def testSort( self ):
+ self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" )
+
+class TestSamfileIndex( unittest.TestCase):
+
+ def testIndex( self ):
+ samfile = pysam.Samfile( "ex1.bam", "rb" )
+ index = pysam.IndexedReads( samfile )
+ index.build()
+
+ reads = collections.defaultdict( int )
+
+ for read in samfile: reads[read.qname] += 1
+
+ for qname, counts in reads.iteritems():
+ found = list(index.find( qname ))
+ self.assertEqual( len(found), counts )
+ for x in found: self.assertEqual( x.qname, qname )
+
if __name__ == "__main__":
# build data files