1 #include <boost/test/auto_unit_test.hpp>
2 #include <boost/filesystem/operations.hpp>
3 namespace fs = boost::filesystem;
4 #include <boost/assign/list_of.hpp>
5 #include <boost/assign/list_inserter.hpp>
6 #include <boost/assign.hpp>
7 namespace assign = boost::assign;
13 #include "alg/mussa.hpp"
17 //! can we initialize a mussa object?
18 BOOST_AUTO_TEST_CASE( mussa_simple )
21 BOOST_CHECK_EQUAL(m.get_name(), "" );
22 BOOST_CHECK_EQUAL(m.get_window(), 0);
23 BOOST_CHECK_EQUAL(m.get_threshold(), 0);
24 BOOST_CHECK_EQUAL(m.get_analysis_mode(), Mussa::TransitiveNway);
25 m.set_name( "hello" );
26 BOOST_CHECK_EQUAL(m.get_name(), "hello" );
28 BOOST_CHECK_EQUAL(m.get_window(), 30);
30 BOOST_CHECK_EQUAL(m.get_threshold(), 21);
31 BOOST_CHECK_EQUAL(m.get_soft_threshold(), 21);
32 m.set_soft_threshold(19);
33 BOOST_CHECK_EQUAL(m.get_soft_threshold(), 21);
34 m.set_soft_threshold(35);
35 BOOST_CHECK_EQUAL(m.get_soft_threshold(), 30);
36 m.set_soft_threshold(25);
37 BOOST_CHECK_EQUAL(m.get_soft_threshold(), 25);
38 m.set_analysis_mode(Mussa::RadialNway);
39 BOOST_CHECK_EQUAL(m.get_analysis_mode(), Mussa::RadialNway);
42 BOOST_CHECK_EQUAL(m.get_name(), "" );
43 BOOST_CHECK_EQUAL(m.get_window(), 0);
44 BOOST_CHECK_EQUAL(m.get_threshold(), 0);
45 BOOST_CHECK_EQUAL(m.get_analysis_mode(), Mussa::TransitiveNway);
48 BOOST_AUTO_TEST_CASE( mussa_analysis_name )
51 m.set_analysis_mode( Mussa::TransitiveNway );
52 BOOST_CHECK_EQUAL( m.get_analysis_mode_name(), "Transitive" );
53 m.set_analysis_mode( Mussa::RadialNway );
54 BOOST_CHECK_EQUAL( m.get_analysis_mode_name(), "Radial" );
55 m.set_analysis_mode( Mussa::EntropyNway );
56 BOOST_CHECK_EQUAL( m.get_analysis_mode_name(), "Entropy" );
57 m.set_analysis_mode( Mussa::RecursiveNway);
58 BOOST_CHECK_EQUAL( m.get_analysis_mode_name(), "[deprecated] Recursive" );
61 BOOST_AUTO_TEST_CASE( mussa_sequences )
63 std::string s0("AAAANNNN");
64 std::string s1("GGGGNNNN");
65 std::string s2("TTTTNNNN");
68 analysis.append_sequence(s0);
69 analysis.append_sequence(s1);
70 analysis.append_sequence(s2);
72 BOOST_CHECK_EQUAL( analysis.sequences().size(), 3 );
73 BOOST_CHECK_EQUAL( analysis.sequences()[0], s0);
74 BOOST_CHECK_EQUAL( analysis.sequences()[1], s1);
75 BOOST_CHECK_EQUAL( analysis.sequences()[2], s2);
78 // for some reason we can call nway once safely but it
79 // somehow changed things and caused a segfault
80 // fixed by adding a return statement in trans_path_search
81 BOOST_AUTO_TEST_CASE ( empty_mussa_set_threshold )
84 m.set_soft_threshold(15);
87 m.set_soft_threshold(25);
91 BOOST_AUTO_TEST_CASE( mussa_load_mupa )
93 fs::path mupa_path(EXAMPLE_DIR);
94 mupa_path /= "mck3test.mupa";
97 m1.load_mupa_file( mupa_path );
99 BOOST_CHECK_EQUAL( m1.get_name(), std::string("mck3test") );
100 BOOST_CHECK( m1.size() > 0 );
103 fs::path result_path = fs::initial_path() / "mck3test_w30_t20";
104 m2.load( result_path );
105 BOOST_CHECK_EQUAL( m2.get_name(), result_path.leaf() );
106 BOOST_CHECK_EQUAL( m1.size(), m2.size() );
110 BOOST_AUTO_TEST_CASE( mussa_load_full_path )
113 fs::path full_path(fs::path(EXAMPLE_DIR) / "mck3test.mupa");
114 m1.load_mupa_file( full_path );
117 BOOST_CHECK( m1.size() > 0);
118 BOOST_CHECK_EQUAL( m1.get_window(), 30 );
119 BOOST_CHECK_EQUAL( m1.get_threshold(), 20);
122 BOOST_AUTO_TEST_CASE( mussa_load_analysis )
124 fs::path example_dir(EXAMPLE_DIR);
126 m1.load_mupa_file( example_dir / "mck3test.mupa" );
130 m2.load( fs::initial_path() / "mck3test_w30_t20");
132 BOOST_CHECK_EQUAL( m1.size(), m2.size() );
133 BOOST_CHECK_EQUAL( m1.get_window(), m2.get_window() );
134 BOOST_CHECK_EQUAL( m1.get_threshold(), m2.get_threshold() );
137 BOOST_AUTO_TEST_CASE( mussa_load_motif )
139 string data = "AAGG 1.0 1.0 0.0\n"
143 istringstream test_istream(data);
146 m1.append_sequence("AAAAGGGGTTTT");
147 m1.append_sequence("GGGCCCCTTGGTT");
148 m1.load_motifs(test_istream);
150 for (vector<Sequence>::const_iterator seq_i = m1.sequences().begin();
151 seq_i != m1.sequences().end();
154 BOOST_CHECK( seq_i->motifs().size() > 0 );
158 BOOST_AUTO_TEST_CASE( mussa_add_motif )
160 vector<string> motifs;
161 motifs.push_back("AAGG");
162 vector<Color> colors;
163 colors.push_back(Color(1.0, 0.0, 0.0));
166 m1.append_sequence("AAAAGGGGTTTT");
167 m1.append_sequence("GGGCCCCTTGGTT");
168 m1.add_motifs(motifs, colors);
169 int first_size = m1.motifs().size();
170 BOOST_CHECK_EQUAL( first_size, 1 );
171 m1.add_motifs(motifs, colors);
172 BOOST_CHECK_EQUAL( first_size, m1.motifs().size() );
176 local_align_test(const vector<Sequence> &seqs,
177 const list<ConservedPath::path_type>& result,
178 const list<vector<bool> >& reversed)
180 map<char, vector <char> > m;
181 assign::insert(m)('A', assign::list_of('A')('T') )
182 ('T', assign::list_of('T')('A') )
183 ('G', assign::list_of('G')('C') )
184 ('C', assign::list_of('C')('G') );
185 list<vector<bool> >::const_iterator rc_i = reversed.begin();
187 for(list<ConservedPath::path_type>::const_iterator base_i = result.begin();
188 base_i != result.end();
191 // since the reverse compliment flag is relative to the first sequence
192 // the first one should always be false
193 BOOST_CHECK_EQUAL( (*rc_i)[0], false );
194 const int first_path_basepair_index = (*base_i)[0];
195 const int second_path_basepair_index = (*base_i)[1];
196 const char first_basepair = seqs[0][first_path_basepair_index];
197 const char second_basepair = seqs[1][second_path_basepair_index];
198 // get our index into our reverse compliment map m
199 const int second_compliment_index = (*rc_i)[1];
200 // lookup the forward or reverse compliment depending on our rc flag
201 const char complimented_second = m[second_basepair][second_compliment_index];
203 BOOST_CHECK_EQUAL( first_basepair, complimented_second) ;
208 BOOST_AUTO_TEST_CASE( local_alignment )
210 string s0("GCGCATAT");
211 string s1("AAAAAAAT");
215 analysis.append_sequence(s0);
216 analysis.append_sequence(s1);
217 analysis.set_threshold(3);
218 analysis.set_window(4);
220 NwayPaths npath = analysis.paths();
221 list<ConservedPath::path_type> result;
222 list<vector<bool> > reversed;
223 list<ConservedPath>::iterator pathz_i = npath.pathz.begin();
225 list<ConservedPath> selected_paths;
226 selected_paths.push_back(*pathz_i);
227 analysis.createLocalAlignment(selected_paths.begin(),
228 selected_paths.end(),
232 local_align_test(analysis.sequences(), result, reversed);
237 selected_paths.clear();
238 selected_paths.push_back(*pathz_i);
239 analysis.createLocalAlignment(selected_paths.begin(),
240 selected_paths.end(),
243 local_align_test(analysis.sequences(), result, reversed);
248 BOOST_AUTO_TEST_CASE( subanalysis )
250 Sequence s1("AATGAAGATTTTAATGCTTTAATTTTGTTTTGTAAACTTCGAATTTCCAAAATTTGAAA");
251 Sequence s2("AGGAGCAAGTTCGCTTCATCGAGAATTTTTAATTTTTAGTCAAATTTTCCAATGTCTGA");
254 analysis.append_sequence(s1);
255 analysis.append_sequence(s2);
256 analysis.set_threshold(8);
257 analysis.set_window(8);
260 NwayPaths perfect_path = analysis.paths();
261 int perfect_match_count = perfect_path.pathz.size();
263 Sequence sub1 = s1.subseq(2, s1.size()-4);
264 Sequence sub2 = s2.subseq(2, s2.size()-4);
266 subanalysis.append_sequence(sub1);
267 subanalysis.append_sequence(sub2);
268 subanalysis.set_threshold(7);
269 subanalysis.set_window(8);
270 subanalysis.analyze();
271 NwayPaths one_mismatch_path = subanalysis.paths();
272 int one_mismatch_count = one_mismatch_path.pathz.size();
274 BOOST_CHECK( perfect_match_count < one_mismatch_count );